ID: 900113522

View in Genome Browser
Species Human (GRCh38)
Location 1:1019551-1019573
Sequence GGGAGCTGCGGCGCGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 8, 3: 67, 4: 447}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900113522_900113546 22 Left 900113522 1:1019551-1019573 CCCGCCTCCGCGCCGCAGCTCCC 0: 1
1: 0
2: 8
3: 67
4: 447
Right 900113546 1:1019596-1019618 CTCGGTGTCCGGCCCCGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 95
900113522_900113539 11 Left 900113522 1:1019551-1019573 CCCGCCTCCGCGCCGCAGCTCCC 0: 1
1: 0
2: 8
3: 67
4: 447
Right 900113539 1:1019585-1019607 CCCGGCCGAGCCTCGGTGTCCGG 0: 1
1: 0
2: 0
3: 11
4: 78
900113522_900113543 20 Left 900113522 1:1019551-1019573 CCCGCCTCCGCGCCGCAGCTCCC 0: 1
1: 0
2: 8
3: 67
4: 447
Right 900113543 1:1019594-1019616 GCCTCGGTGTCCGGCCCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 125
900113522_900113542 19 Left 900113522 1:1019551-1019573 CCCGCCTCCGCGCCGCAGCTCCC 0: 1
1: 0
2: 8
3: 67
4: 447
Right 900113542 1:1019593-1019615 AGCCTCGGTGTCCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 19
4: 231
900113522_900113549 27 Left 900113522 1:1019551-1019573 CCCGCCTCCGCGCCGCAGCTCCC 0: 1
1: 0
2: 8
3: 67
4: 447
Right 900113549 1:1019601-1019623 TGTCCGGCCCCGCGGGGGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 117
900113522_900113548 26 Left 900113522 1:1019551-1019573 CCCGCCTCCGCGCCGCAGCTCCC 0: 1
1: 0
2: 8
3: 67
4: 447
Right 900113548 1:1019600-1019622 GTGTCCGGCCCCGCGGGGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 93
900113522_900113536 4 Left 900113522 1:1019551-1019573 CCCGCCTCCGCGCCGCAGCTCCC 0: 1
1: 0
2: 8
3: 67
4: 447
Right 900113536 1:1019578-1019600 GGTCCGGCCCGGCCGAGCCTCGG 0: 1
1: 0
2: 0
3: 10
4: 149
900113522_900113547 25 Left 900113522 1:1019551-1019573 CCCGCCTCCGCGCCGCAGCTCCC 0: 1
1: 0
2: 8
3: 67
4: 447
Right 900113547 1:1019599-1019621 GGTGTCCGGCCCCGCGGGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 178
900113522_900113545 21 Left 900113522 1:1019551-1019573 CCCGCCTCCGCGCCGCAGCTCCC 0: 1
1: 0
2: 8
3: 67
4: 447
Right 900113545 1:1019595-1019617 CCTCGGTGTCCGGCCCCGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 81
900113522_900113533 -7 Left 900113522 1:1019551-1019573 CCCGCCTCCGCGCCGCAGCTCCC 0: 1
1: 0
2: 8
3: 67
4: 447
Right 900113533 1:1019567-1019589 AGCTCCCGGGGGGTCCGGCCCGG 0: 1
1: 0
2: 0
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900113522 Original CRISPR GGGAGCTGCGGCGCGGAGGC GGG (reversed) Intergenic
900113522 1:1019551-1019573 GGGAGCTGCGGCGCGGAGGCGGG - Intergenic
900172157 1:1274336-1274358 GGGTGCTGCGGCGCGGACGTGGG - Intergenic
900204328 1:1425689-1425711 GGGAGCAGCGGGGCTGGGGCTGG + Intergenic
900668560 1:3833874-3833896 TGCAGCTGTGACGCGGAGGCGGG + Exonic
901012291 1:6208681-6208703 GGGCACTGCGGCTCAGAGGCTGG - Intronic
901319541 1:8330954-8330976 GGGAGCTGAGGCTCAGAGGGTGG + Intronic
901627418 1:10631926-10631948 GGGAGCTGCGGTGGGCAGACAGG + Intergenic
902087344 1:13873770-13873792 GGGAGCTGTGGGGAGGAGTCTGG + Intergenic
902586221 1:17439884-17439906 AGGAGCAGCGGAGCCGAGGCGGG - Intergenic
902698759 1:18157483-18157505 GTGGGCTGCAGCGTGGAGGCAGG - Intronic
903510064 1:23868172-23868194 GGGTGTAGCGGCGCGGAGGCTGG + Exonic
904500187 1:30908729-30908751 CGGAGCTGCGAGGCGGAGCCGGG - Exonic
904836472 1:33340723-33340745 GGGAGTTGCGGGGAGGAGGGAGG + Intronic
905108371 1:35577233-35577255 GGCAGCTGCGGCGGCGAGGCAGG + Intronic
905580774 1:39081633-39081655 GGGAGCTGGGGCGCGGCCGCCGG - Intronic
905960089 1:42035903-42035925 AGGAGCCGTGGCGCGGCGGCGGG + Intronic
907322566 1:53614507-53614529 GGGGGCTGCGGTGAGGATGCTGG + Intronic
907510523 1:54954619-54954641 GGGGGCTGCAGGGAGGAGGCTGG + Intergenic
908303315 1:62784140-62784162 TGTAGCTGCGGCGCTGAGGTCGG + Exonic
909925436 1:81432663-81432685 GGGAGCGGCGCCGAGGAGGGGGG - Intronic
910232048 1:84997286-84997308 GGGGTCGGCGACGCGGAGGCGGG + Intergenic
910935086 1:92480818-92480840 GGGAGCTGCAGCGCAGGGGCCGG - Exonic
912246211 1:107964621-107964643 GGGAGCTGCCGGCTGGAGGCGGG + Intronic
912716885 1:111989554-111989576 GGAAGCTGCGGCCGGGAGCCGGG + Intergenic
914250606 1:145918701-145918723 GGGAGCAGGGCCGCGGAGCCTGG - Exonic
914804509 1:150982685-150982707 GGGAGCTGAGGTGAGGTGGCAGG - Intronic
914827371 1:151145697-151145719 GGGGGTTGGGGAGCGGAGGCGGG + Intronic
915491069 1:156250317-156250339 GGGAGCTGAGGCAGGAAGGCTGG + Exonic
915816537 1:158973023-158973045 GGGTGCTGTGGCACAGAGGCAGG - Intronic
915912719 1:159924579-159924601 GGGGGCGGCGGCTGGGAGGCCGG - Intronic
916107303 1:161441292-161441314 GCGAGCGGAGGCGCGGGGGCTGG + Intergenic
916108890 1:161448710-161448732 GCGAGCGGAGGCGCGGGGGCTGG + Intergenic
916110478 1:161456091-161456113 GCGAGCGGAGGCGCGGGGGCTGG + Intergenic
916112063 1:161463501-161463523 GCGAGCGGAGGCGCGGGGGCTGG + Intergenic
916113650 1:161470882-161470904 GCGAGCGGAGGCGCGGGGGCTGG + Intergenic
917141624 1:171841411-171841433 GGCAGCCGCGGGGCGGGGGCGGG + Intergenic
919897448 1:202018204-202018226 CTGAGCTGCAGCGTGGAGGCAGG - Intergenic
920260513 1:204685165-204685187 CGGAGCTGCGGTGCCGGGGCAGG + Intronic
920528485 1:206685278-206685300 GGGGGCTGCGGCGGCGGGGCCGG - Exonic
920572130 1:207025082-207025104 GGGGGCGGGGGCGGGGAGGCGGG + Intronic
921010303 1:211134195-211134217 GGGAGCAGCGGCGCCTGGGCCGG + Intergenic
922766397 1:228158683-228158705 GGGGGCCGCGGCGCGGGGGCGGG - Exonic
922994410 1:229944471-229944493 GGGAGCTGCTGAGCGGTGCCAGG + Intergenic
923052735 1:230400099-230400121 GAGAGCTGCAGGGTGGAGGCGGG - Intronic
923631256 1:235650303-235650325 GGGATCTGCGGGGCGGGGCCGGG + Intronic
924801420 1:247331712-247331734 GGAGGCGGCGCCGCGGAGGCCGG + Exonic
1062890542 10:1056684-1056706 CGGGGCTGCGGGGCGGAAGCCGG + Intronic
1063003832 10:1949786-1949808 GGGAGCTGAGGCACGGAGGTTGG - Intergenic
1063006818 10:1979590-1979612 GGGTGCTTCGGAGCAGAGGCAGG + Intergenic
1063995137 10:11611690-11611712 GGGGCCGGAGGCGCGGAGGCGGG - Intronic
1065239850 10:23694668-23694690 CGGAGGAGCGGCGCGGAGGGTGG - Intergenic
1065763206 10:29002397-29002419 GGCAGCTGCGCCGAGGAAGCTGG + Intergenic
1069043317 10:63717564-63717586 GGGGGGGGCGGCGCCGAGGCAGG - Intergenic
1069544388 10:69318490-69318512 GGGAGGTGCGAGGCGCAGGCAGG - Intronic
1069703256 10:70441363-70441385 GGGGGCTGCGGCTCCGAGCCGGG - Intronic
1070167691 10:73911076-73911098 GGGAGGGGCGGCGCCGGGGCGGG + Exonic
1070642024 10:78177189-78177211 AGTAGCTGCGGCACAGAGGCGGG - Intergenic
1071504298 10:86223372-86223394 GGAAGCTGCGGAGCTGTGGCTGG + Intronic
1072188074 10:93060929-93060951 GGGAGGTGCCCCGCGGAGCCGGG + Intergenic
1072650625 10:97292412-97292434 GGGGGCTGAGGCGCGGGGGTCGG - Intronic
1072926279 10:99620196-99620218 GGGGCCGGCGGCGGGGAGGCCGG - Exonic
1073290057 10:102409099-102409121 GGGGGCCGCGGCGCGCCGGCCGG - Intronic
1075520959 10:123143230-123143252 GGGGGCTGGGGAGCGGAGGAAGG + Intergenic
1076035532 10:127196221-127196243 GCGAGCTGCGGCGCGGGGGCCGG - Intronic
1076149356 10:128150074-128150096 GGGCGCTGCGGGGCGCCGGCTGG - Intergenic
1076361750 10:129894533-129894555 AGGAGCTGGGGCACAGAGGCGGG - Intronic
1076373908 10:129971353-129971375 GGGTGCGTCGGCGCGGGGGCGGG + Intergenic
1076615614 10:131752227-131752249 GGGAGCTGTGGGGCTGGGGCTGG + Intergenic
1076694789 10:132242258-132242280 GGGAGCTGCTGGGAGGAGGGCGG + Intronic
1076786524 10:132752442-132752464 GGGGGCTGTGGCGTGGAGGGGGG + Intronic
1077089475 11:771925-771947 GGTGGCTGCTGTGCGGAGGCTGG - Intronic
1077140153 11:1020692-1020714 GGCAGCTGCGGCGTGGTGGGTGG + Exonic
1077148705 11:1058250-1058272 GGGAGCTGGGGCGACCAGGCAGG + Intergenic
1077313349 11:1903306-1903328 GGGAGCTGTGGAGCGGGGGGTGG + Intergenic
1077371237 11:2182556-2182578 GGGACCTGTGGGGCGGGGGCGGG - Intergenic
1077475517 11:2788510-2788532 GGGAGCTGCCGAGGAGAGGCAGG - Intronic
1077923118 11:6655910-6655932 GGGGGCGGCGGCGCGGAGCGCGG - Intergenic
1078317433 11:10305010-10305032 GGGAGCGGCGGGGCGGGGCCTGG - Intronic
1078801061 11:14644273-14644295 GGGAGCAGCGCCGCGGCTGCTGG - Exonic
1079402813 11:20119451-20119473 GGAAGCTGGGGCGGGGACGCTGG - Intronic
1080012339 11:27472041-27472063 GGGCGCCGCGGGGCGGAGCCAGG - Intronic
1080727912 11:34916223-34916245 CGGAGATGCGGCGCGCAGGTAGG - Exonic
1081620827 11:44618373-44618395 GGGGGCTGCGGATCGGGGGCGGG + Intronic
1081938138 11:46918595-46918617 CGGGGCTGCGGCGCGGGGGGCGG - Exonic
1082816709 11:57514361-57514383 GGAAGCTGCAGCGCGCAGACAGG - Intronic
1083276570 11:61600294-61600316 GGGACCTGCAGCGAGGAGGTTGG - Intergenic
1083616376 11:64028540-64028562 GGGAGCAGAGGGGCTGAGGCCGG - Intronic
1083658316 11:64240957-64240979 GGCAGCGGCGTCGCGGGGGCGGG + Intergenic
1083766463 11:64843756-64843778 GGGGGCTGTGGCGCCGGGGCCGG - Intronic
1083822610 11:65181652-65181674 GGGGGCTGGGGCGCGGCGGAAGG - Exonic
1084310434 11:68313159-68313181 GGGACTTGGGGCGCGGAGGCGGG + Intronic
1084600460 11:70142520-70142542 GGGAGTGGCGGGGCGGGGGCAGG - Intronic
1087014545 11:93542993-93543015 GGTTGCTGCGGGGCGGGGGCTGG - Intronic
1088607534 11:111545780-111545802 GGGAGCTGAGGGGTGGAAGCAGG - Intronic
1089262542 11:117232647-117232669 GGGAGGTGCCGCGCGCGGGCCGG + Exonic
1089300764 11:117497431-117497453 GGGGGCTGCGGCGGGGAGCCTGG + Intronic
1089383435 11:118052349-118052371 GGGAGCTGCTGAGGGCAGGCTGG + Intergenic
1089675104 11:120084067-120084089 GGGAAATGCGGAGCTGAGGCAGG - Intergenic
1090275090 11:125413424-125413446 GGGAGCTGTGGCATGGACGCTGG - Intronic
1090438706 11:126708768-126708790 GGGAGCTGGAGAGCGGAGGGAGG - Intronic
1091243409 11:134069661-134069683 GGCAGCTGCGGCGTGGGCGCTGG + Intronic
1091616356 12:2053624-2053646 GGGAGCCCCGGCGAGGCGGCGGG - Intronic
1092860734 12:12717285-12717307 GGGAGCCGCCCCGCCGAGGCTGG - Exonic
1093894818 12:24563327-24563349 GGGACGCGCGGCGCGGAGCCTGG - Intergenic
1095476152 12:42589406-42589428 GGGGGCTGCGGCGCGGTGGTGGG - Intronic
1095752373 12:45727547-45727569 GGCGGCGGCGGCGCGGCGGCAGG + Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096191539 12:49623360-49623382 GGACGCGGCGGCGCGGGGGCGGG + Intronic
1097155126 12:57006606-57006628 GGGCGCTGCGGCCGGGCGGCGGG - Intergenic
1101466912 12:104958333-104958355 CGGGGCTGCCGCGCGGGGGCGGG - Intronic
1102785213 12:115599214-115599236 GGGAGCTGGGGCGGGGTGGGGGG + Intergenic
1102887643 12:116533830-116533852 GGGAGCTGGGGCGGGGCGGAGGG + Intergenic
1102913818 12:116738082-116738104 TGTCGCTGCGGAGCGGAGGCGGG - Intergenic
1103076152 12:117984301-117984323 GGGAGCTGCAGGGCAGATGCAGG - Intergenic
1103330694 12:120151855-120151877 GTGAGCTGCGGCTGGGAGGCAGG - Intronic
1103972968 12:124683547-124683569 GGCAGCTGCCTGGCGGAGGCTGG - Intergenic
1104663968 12:130634228-130634250 GGGAGCGGAGACGGGGAGGCGGG + Intronic
1104939034 12:132386313-132386335 GGCGGCTGCGGCTCCGAGGCCGG - Intergenic
1104988549 12:132611255-132611277 GGGAGCTGAGGCGGGGAGGGTGG + Intergenic
1105407210 13:20142511-20142533 GGGAGCTGGGGGGCAGGGGCGGG + Exonic
1110096046 13:71522384-71522406 GGGAGGTGCGGCGTGGTGGTAGG - Intronic
1113441250 13:110330388-110330410 GGGAGGCGCGGGGTGGAGGCGGG + Intronic
1113962196 13:114132352-114132374 AGGATCTGCGGAGGGGAGGCGGG + Intronic
1114070214 14:19099497-19099519 GGGAGCGGGGCCTCGGAGGCTGG + Intergenic
1114092050 14:19300505-19300527 GGGAGCGGGGCCTCGGAGGCTGG - Intergenic
1114250443 14:20955514-20955536 AGGAGCTACAGCGCGGAGACTGG + Exonic
1114640039 14:24213455-24213477 GGACGCTGAGGGGCGGAGGCGGG - Exonic
1115217339 14:31026261-31026283 GCTGGCTGCGGGGCGGAGGCCGG + Exonic
1115399310 14:32939390-32939412 GGGAGCAGCGGCCCGGCGGCAGG - Intronic
1115474571 14:33800612-33800634 GGGGGCGGCGGCGCGGGGGGCGG + Exonic
1116658258 14:47676179-47676201 GGCAGAGGAGGCGCGGAGGCAGG - Intergenic
1117516030 14:56502144-56502166 GGGAGCTGGGGTGTGGAGGGTGG - Intronic
1117898540 14:60510842-60510864 GGGAGCTGCGGCGCTGAGAAAGG + Intronic
1118796829 14:69152243-69152265 GGGGGCTGCGACCCGGGGGCTGG - Intronic
1119003925 14:70907617-70907639 GCGAGCGGCGGGGCGGAGGACGG - Exonic
1119735403 14:76978232-76978254 GTGAGCTGAGGGGCTGAGGCTGG - Intergenic
1120521859 14:85533817-85533839 GGGCGCGGGGGTGCGGAGGCCGG - Intronic
1121473349 14:94173972-94173994 GGGGGCTGGGGGGCGGGGGCTGG - Intronic
1121661132 14:95635963-95635985 GGGAGGTGCTGGGGGGAGGCTGG + Intergenic
1122108796 14:99480908-99480930 GGCGGCTGCGGCCCGGGGGCGGG - Intergenic
1122179800 14:99946758-99946780 GGGAGCTGGGGCGGGGCTGCGGG + Intergenic
1122558011 14:102592006-102592028 GGGGGCCGCGGCGCGGGGGACGG - Intergenic
1122627271 14:103091005-103091027 GGGAGGTGAGGTGCGGAAGCTGG + Intergenic
1122701721 14:103594138-103594160 GGGAGCTGAGGCTTGCAGGCAGG - Intronic
1122910924 14:104827248-104827270 CGGACCTGCGGGGCGGGGGCGGG - Intergenic
1123006000 14:105324188-105324210 GGCAGCTGCGGTGCTGTGGCGGG + Intronic
1123042964 14:105497938-105497960 GGAGGCTGCGGAGCGCAGGCGGG + Exonic
1123057322 14:105577530-105577552 GGGAGCGGCGGAGCGGGTGCTGG - Intergenic
1123080492 14:105691544-105691566 GGGAGCGGCGGAGCGGGTGCTGG + Intergenic
1123457742 15:20441320-20441342 GGAAGCTGAGGCTTGGAGGCTGG + Intergenic
1123660328 15:22559097-22559119 GGAAGCTGAGGCTTGGAGGCTGG - Intergenic
1124118213 15:26867191-26867213 CGGAGCTGCAGGGCGGCGGCGGG + Intronic
1125529884 15:40406097-40406119 GGGAGCGCCAGCGCGGGGGCGGG + Intronic
1125652928 15:41332362-41332384 GGCAGCTGCGGGCCGGCGGCTGG + Exonic
1127326038 15:57896260-57896282 GGGAGGTGCGGCGGGGGGGGGGG - Intergenic
1128213272 15:65916875-65916897 GCGAGCTGCAGCGCCGAGGACGG - Exonic
1129304369 15:74648340-74648362 GGCAGCTACGGCTCAGAGGCAGG + Intronic
1129520989 15:76186237-76186259 GGGAACTGAGGCCCGGAGGTGGG - Intronic
1129660520 15:77550508-77550530 GGCAGCTGTGGGGCTGAGGCCGG + Intergenic
1129761382 15:78131109-78131131 GGGAGGGGCGGCGGGGCGGCGGG + Intronic
1130040870 15:80404454-80404476 GGGAGGGGCGGCGCGGAGCCCGG - Exonic
1131049091 15:89334641-89334663 GGGGTCGGCGGCGGGGAGGCCGG - Intronic
1132725110 16:1335031-1335053 GGGGGCAGCGGAGCAGAGGCTGG - Intronic
1132756480 16:1487764-1487786 GGAAGCTGCAGCGCCGAGGCCGG - Exonic
1132779334 16:1614282-1614304 GGGAGCCCCGGCGCGGGCGCGGG - Intronic
1132854510 16:2038785-2038807 GGGAGCTGCCGCGCGGAATGAGG - Exonic
1132865503 16:2091079-2091101 GCGTGCTGCGGCTCGGAGCCTGG - Exonic
1132875572 16:2135561-2135583 GGGCGCTGGGCCGCAGAGGCAGG + Exonic
1132987618 16:2776269-2776291 GGGAGCTGAGGCTCTGAGCCTGG + Intronic
1133236058 16:4387961-4387983 AGGAGCTGCGGCACGCAGGTGGG - Intronic
1133272361 16:4616438-4616460 GGGCGCTGGGCCGGGGAGGCCGG + Intergenic
1135382696 16:22008005-22008027 CGGAGCTGGGGCGCGGCGGCTGG + Intronic
1136181262 16:28554159-28554181 GGGAGCCGCGGCGCGGAGGGAGG - Intronic
1136402853 16:30028027-30028049 TGGAGCTGCGGCCCAGAGGCAGG + Intronic
1137368998 16:47887335-47887357 GGGGGCTGCGGGTGGGAGGCAGG - Intergenic
1137412853 16:48244280-48244302 GGAAGCGGAGGCGTGGAGGCGGG + Exonic
1138179140 16:54930647-54930669 GGGGGCCGCGGAGGGGAGGCGGG + Intergenic
1138247634 16:55479298-55479320 GGGGGCTGGGGCGCGGGGGCCGG + Exonic
1138761768 16:59552795-59552817 GGGGGGTGCGGCGGGTAGGCAGG - Intergenic
1139528098 16:67528780-67528802 GGGAGGGGCGGCGGGGCGGCGGG + Intronic
1140478628 16:75251118-75251140 GGAAACTGAGGCTCGGAGGCAGG + Intronic
1141553183 16:84819812-84819834 GGCAGCTGAGGCGCGGGCGCCGG - Intergenic
1141831314 16:86511248-86511270 GGCTGCGGCGGCGCGGCGGCCGG + Exonic
1142176319 16:88647048-88647070 GGGGGCTGCGGGGCCCAGGCAGG - Intronic
1142259843 16:89037529-89037551 GTGGGCTGTGGCGCCGAGGCTGG + Intergenic
1142278423 16:89135244-89135266 GGGGGCTGCAGCGTGCAGGCGGG + Intronic
1142400533 16:89856035-89856057 GGGACCTGCGGTGGGGAAGCGGG - Intronic
1142567675 17:851203-851225 GGGGGATGCGGTGGGGAGGCCGG + Intronic
1142590266 17:1001744-1001766 GGGGGATGGGGCGCTGAGGCAGG + Exonic
1142643795 17:1299647-1299669 GGGAGCTGCGGTCAGGAGGGTGG - Exonic
1142767877 17:2075860-2075882 TGGAGCTGCAGCGCCCAGGCAGG - Intronic
1143240433 17:5439002-5439024 GGGCGCGGCAGCGCGGAGGCCGG + Exonic
1143262364 17:5608931-5608953 GGGAGCTGGGGCAAGGCGGCAGG - Intronic
1143562675 17:7705027-7705049 GGGGGCTGAGGCGGGGCGGCGGG + Intergenic
1143830302 17:9645680-9645702 GGGAGCGGCGGCGGCGGGGCCGG - Exonic
1144586853 17:16492258-16492280 CGGAGCTCCGGCGCGGAGGCGGG - Intergenic
1144656991 17:17043008-17043030 GGGAGCCGCGGGTCGGCGGCCGG + Intronic
1145077437 17:19867586-19867608 GGAAGCTGCCGCGCGGAGCCAGG + Exonic
1146371044 17:32265869-32265891 GGGAGCGGCGGGGCCGGGGCCGG + Intergenic
1146448880 17:32955718-32955740 GGGAGCTGAGGCAGGGAGGATGG + Intergenic
1147907483 17:43832716-43832738 GGGCGGGGCGGGGCGGAGGCTGG - Intronic
1147931939 17:43987243-43987265 GAGAGCAGCGGCGGGGAGGGAGG - Intronic
1148156834 17:45429590-45429612 GGGCGCTGGGGCGCGGAGGCGGG - Intronic
1148271789 17:46267159-46267181 CGGGGCGGCGGCGCGGCGGCCGG - Intergenic
1148499531 17:48079097-48079119 GGGAGGTGCGGGGCCGGGGCTGG - Intronic
1148786646 17:50149102-50149124 GGCAGGGGCGGCGCGGGGGCAGG + Intronic
1149659346 17:58326261-58326283 GGAGGCTGCTGGGCGGAGGCTGG - Intronic
1150764596 17:67993395-67993417 CGGGGCGGCGGCGCGGCGGCCGG + Intronic
1151559171 17:74861555-74861577 GGGCGCGGCGGGGCGGGGGCGGG + Intergenic
1151939027 17:77281363-77281385 GGGAGGGGCGGGGCGGGGGCGGG + Intronic
1152045182 17:77930684-77930706 GGGAGCTGCAGGGGGGAAGCTGG - Intergenic
1152581088 17:81165899-81165921 GGAGGCAGCGGCGCGCAGGCCGG + Intronic
1152625695 17:81387031-81387053 CGGAGCTGGGGCGCGGAGGGAGG + Intergenic
1152695357 17:81741281-81741303 GGCAGCGCCGGCGGGGAGGCAGG - Intergenic
1152782165 17:82231341-82231363 GGGAGGTGCGGGGCGAAGGGGGG - Intronic
1152853083 17:82648797-82648819 GGGCGGGGCGGGGCGGAGGCGGG + Intergenic
1153285154 18:3449995-3450017 GGGGGCGGCGGTGCGGACGCGGG - Intronic
1154202331 18:12308177-12308199 GCGAGCGGCGGGGCGGGGGCGGG + Exonic
1154348574 18:13564683-13564705 GGGGGCGGCAGCGCAGAGGCGGG - Intronic
1155066986 18:22276452-22276474 GGGACGTGGGGCGGGGAGGCGGG + Intergenic
1155519855 18:26656931-26656953 CGGAGCGGCCGCGGGGAGGCTGG + Intronic
1157095168 18:44680440-44680462 GGGGCCCGCGGCGCGGAGGGAGG - Intronic
1157632437 18:49112110-49112132 GGGGGGTGCGGAGAGGAGGCGGG - Intronic
1157811544 18:50700652-50700674 GGGAGGTGCGGCTCTGAGGAGGG - Intronic
1158194152 18:54866276-54866298 GGGGGCAGGGGCGGGGAGGCGGG - Intronic
1160204663 18:76822753-76822775 GGGAGCGGCGGGGCGGGGGCGGG + Intronic
1160390493 18:78527695-78527717 GGGAGCTGTGGGGAGCAGGCAGG - Intergenic
1160426340 18:78781636-78781658 GAGAGCAGCGGCGCCGAAGCCGG - Intergenic
1160791582 19:925971-925993 GGGAGGGGCGGGGCGGGGGCCGG + Intronic
1160887118 19:1355173-1355195 CGGGGCTGAGGCGAGGAGGCCGG + Intronic
1161063472 19:2226668-2226690 GGCAGCCGCGGCAAGGAGGCAGG + Exonic
1161628859 19:5341218-5341240 GCGAGCTGCAGAGAGGAGGCGGG - Intergenic
1161752945 19:6110610-6110632 GGAAGGTGGGGCGCGGAGCCTGG - Intronic
1161998871 19:7730918-7730940 GGGTGGTGCGGGGCGGGGGCTGG - Intronic
1162233058 19:9283486-9283508 GGGAGCCGCGGAGCAGAGGGTGG + Intergenic
1162480579 19:10924735-10924757 GGGAGGTTAGGAGCGGAGGCAGG - Intronic
1162778685 19:12995718-12995740 GGGCGCAGCGCGGCGGAGGCCGG + Exonic
1163834311 19:19563730-19563752 GGGGGCTGAGGAGCAGAGGCCGG - Intronic
1164555640 19:29248783-29248805 GGGAGCTGGGGGATGGAGGCAGG + Intergenic
1165184222 19:34002817-34002839 GGGAACAGAGGCGGGGAGGCTGG + Intergenic
1165236889 19:34428679-34428701 CGGAGTTGCGGAGCGGGGGCAGG + Intronic
1165243011 19:34482137-34482159 GGCAGCGGCGGCCCCGAGGCCGG + Exonic
1165737133 19:38183840-38183862 CGGAGCTCGGGCGAGGAGGCTGG + Intronic
1166084497 19:40466020-40466042 GGGAGGTGGAGCGCGGAGGCAGG - Intergenic
1166094536 19:40530693-40530715 GGGCGGGGCGGCGCGGGGGCGGG + Intronic
1166361638 19:42255024-42255046 GGGAGCCGCGGCCCGGAATCGGG - Exonic
1166368107 19:42287302-42287324 GGAAGCTGCGGCGGGGCAGCAGG - Exonic
1166546898 19:43639518-43639540 GGGGGCTGCGGCACGGCGGCCGG + Intronic
1167019066 19:46861006-46861028 GAGAGCCGCGGCGCGGCGGCAGG + Intergenic
1167098845 19:47391663-47391685 GGGAGCCGCGGAAGGGAGGCCGG - Intergenic
1167371581 19:49085735-49085757 GGGACCTGTGGCGGGGACGCGGG - Intronic
1167579019 19:50331264-50331286 GGGAGCTGGGGTGGGGGGGCGGG - Intronic
1168144910 19:54415517-54415539 GGGGGCAGCGGGGCGGACGCCGG - Exonic
1168148199 19:54430966-54430988 TGGAGCTGTGGGGCGTAGGCGGG + Intronic
1168339121 19:55613802-55613824 GGGGGCTGCGGCGGGGGGCCGGG - Exonic
1168544727 19:57240842-57240864 GGGGGCTGCGGCGAGCAGGGCGG - Intronic
925028042 2:625079-625101 GGGAGGTGTGGCGCGGAGGAAGG - Intergenic
925984983 2:9207644-9207666 GGGGGCTGCGGCGGGGAGCTCGG - Intronic
927153034 2:20206369-20206391 GGGGGCGGGGGCGGGGAGGCAGG + Intronic
927472214 2:23385238-23385260 GGCGGCGGCGGCGCGGGGGCTGG - Exonic
927472235 2:23385297-23385319 GGGCGCTGCGGAGCCGGGGCCGG - Exonic
927558159 2:24050111-24050133 GGGGTCTGCGGCCCGGAGGCGGG + Intronic
929188564 2:39120295-39120317 GGGGGCTGCGGCCGGGAAGCGGG + Intronic
931021240 2:58046990-58047012 CGGAGCTGAGGCCCGGGGGCTGG - Intronic
932036426 2:68251838-68251860 GGGACCGGCGGCGCGGGGGTGGG + Intronic
932314149 2:70768377-70768399 GGGCGCTGCGGGGAGGAGGGGGG - Intergenic
932329166 2:70887864-70887886 GGGAGCGGAGACGCGGAAGCCGG - Intergenic
934566974 2:95346591-95346613 GGCGGCGGCGGCGCGGCGGCGGG - Intronic
935063806 2:99631035-99631057 GTGAGCTGCTGCAGGGAGGCAGG + Intronic
935073782 2:99720234-99720256 GGGAGCTGGGGCCCAGAGGGTGG + Intronic
936556776 2:113503428-113503450 GGGGGCGGTGGCGCAGAGGCCGG - Intergenic
936993879 2:118393657-118393679 GGGACCTGAGGCTCGCAGGCAGG - Intergenic
937210953 2:120270468-120270490 GTGAGCTGAGGAGAGGAGGCTGG + Intronic
938137101 2:128768400-128768422 GGGAGCTGGGGAGAGAAGGCAGG + Intergenic
938263661 2:129911757-129911779 GGGAGCTCCGGCAGGGAGGCTGG - Intergenic
938297645 2:130188360-130188382 GGGAGCTGCTGCAGGGTGGCGGG + Intronic
938365003 2:130727481-130727503 GGCAGCTGGGGCAGGGAGGCGGG + Intergenic
938407393 2:131040064-131040086 GGGAACAGCGGAGCGGAGGACGG + Exonic
941929968 2:170929426-170929448 GGGAGCTGCGGGCTGGAGGCGGG + Intronic
942268260 2:174248730-174248752 GGGAGGAGCCGCGCGGCGGCAGG + Intergenic
942578565 2:177392609-177392631 GGGAGCGCCGGCGCGGTGGGTGG + Intronic
943725252 2:191245776-191245798 GGGAGACGCGGCGCTGCGGCGGG + Intronic
944203738 2:197135742-197135764 GGGAGCAGGGGCCGGGAGGCTGG - Intronic
946130108 2:217600121-217600143 GGAAGCTGCAGTGTGGAGGCTGG - Intronic
946191599 2:218010540-218010562 GCGCGCTGCGGGGCGGATGCCGG + Intergenic
946191615 2:218010587-218010609 GGGAGCCGCGCGGGGGAGGCGGG + Intergenic
947188253 2:227473036-227473058 GGGAGCCGCGGTGCGGAGCGAGG + Intronic
948189352 2:236046014-236046036 GGGAGCTGCTGGGGGGAGGTAGG + Intronic
948684101 2:239659360-239659382 GGGAGCGGCGGAGAGGAGGGAGG - Intergenic
948806688 2:240456151-240456173 GGAGGCTGAGGCGCGGGGGCCGG + Intronic
949014745 2:241702638-241702660 GGGGACTGCGGCGCGGAGGCGGG + Intronic
949032241 2:241802624-241802646 GGGGGCTGCGGGGCAGAGGGAGG + Intronic
1169367218 20:5001355-5001377 GGCAGGTGCGGCCCGCAGGCCGG + Intronic
1172529312 20:35619120-35619142 GGGCGCGGGGGCGCGGGGGCTGG - Intronic
1172549093 20:35784944-35784966 GGGAGCTGAGGTGGGGAGGATGG + Intronic
1172662049 20:36574445-36574467 GGGGGGGGCGGCGCGGAGGTGGG + Intronic
1172698075 20:36835844-36835866 GGCGGCGGCGGCGGGGAGGCGGG - Intronic
1172880251 20:38195146-38195168 GGGAGCAGAGGCGGGGAAGCTGG + Intergenic
1173615657 20:44401346-44401368 GGTGGCCGCGGCGTGGAGGCAGG + Exonic
1173649310 20:44652862-44652884 GGGAGCGGTGGGGAGGAGGCGGG - Intergenic
1173793007 20:45840479-45840501 GGGAGCTGCTGCGCAGTGGCGGG - Intronic
1174607023 20:51768431-51768453 GCGGGCGGCGGCGCGGAGGCCGG - Exonic
1174813560 20:53667592-53667614 GGAAGCTGAGGCGTGGTGGCCGG + Intergenic
1175428880 20:58889251-58889273 CCGGGCTGCGGCGCGGCGGCTGG + Intronic
1175814642 20:61877145-61877167 GGGAGCTGAGCCCAGGAGGCTGG - Intronic
1176232400 20:64039041-64039063 GGGATCTGCGCCTCGGTGGCGGG + Intronic
1179909130 21:44438721-44438743 GGGAGGGGCGACGCGGGGGCAGG + Intronic
1179987423 21:44929425-44929447 GTGAGCTGCGATGCGGAGGTGGG + Intronic
1180488684 22:15822059-15822081 GGGAGCGGGGCCTCGGAGGCTGG + Intergenic
1180762254 22:18219793-18219815 GGCAGCTGCTGCGGGGAGGCGGG + Intergenic
1180773413 22:18404815-18404837 GGCAGCTGCTGCGGGGAGGCGGG - Intergenic
1180804764 22:18654364-18654386 GGCAGCTGCTGCGGGGAGGCGGG - Intergenic
1180805980 22:18715046-18715068 GGCAGCTGCTGCGGGGAGGCGGG + Intergenic
1181160663 22:20957794-20957816 GGCAGCTGCGGGGCGGAGGGTGG + Intergenic
1181192509 22:21151748-21151770 GGCAGCTGCTGCGGGGAGGCGGG - Intergenic
1181216930 22:21340827-21340849 GGCAGCTGCTGCGGGGAGGCGGG + Intergenic
1181277223 22:21694677-21694699 GGGAGGTGGGGCGTGGCGGCTGG + Intronic
1181811181 22:25404884-25404906 GGGACTTGGGGCCCGGAGGCGGG - Intronic
1183076794 22:35432516-35432538 GAGAGCTGCTGCGTGGAGTCTGG + Intergenic
1183270580 22:36860359-36860381 GGGAGCTCAGGAGCAGAGGCTGG + Intergenic
1183354367 22:37350541-37350563 GGGCCCTGCGGTGGGGAGGCAGG - Intergenic
1183924763 22:41197723-41197745 GCGAGCTGAGGCACGGTGGCAGG + Intergenic
1184229593 22:43151521-43151543 GGGAGGGGCGGGGCGGATGCGGG + Intronic
1184523542 22:45009055-45009077 GCGAGCGGCGGCGTGGCGGCCGG - Intronic
1184533737 22:45072502-45072524 GGGAGCTGCGGCGGGGGAGGAGG - Intergenic
1184636136 22:45833283-45833305 GGGAGGTGGGGTGAGGAGGCAGG + Intronic
1184655054 22:45936903-45936925 GGCAGCTGCGGCTGGGAGGGTGG - Intronic
1184807334 22:46803470-46803492 AGGAGCTGAGGCGGGGAGGGCGG + Intronic
1185313895 22:50170622-50170644 GGGACGCGCGGCGCGGGGGCGGG - Intergenic
1185398446 22:50604206-50604228 GGGGGCTCCGGCTCCGAGGCGGG - Exonic
1185417946 22:50720339-50720361 GGGGGCGGCGGCGAGAAGGCCGG - Intergenic
1203235243 22_KI270731v1_random:145797-145819 GGCAGCTGCTGCGGGGAGGCGGG - Intergenic
949929117 3:9064425-9064447 CAGAGCTGCGGCGCTGGGGCCGG + Exonic
950005846 3:9690438-9690460 GGGAGGTGCGCCTAGGAGGCTGG - Intronic
950024296 3:9810044-9810066 GGGAGCTGGGGCCCGGGCGCCGG + Exonic
950500199 3:13358859-13358881 AGGAGCTGCAGCCTGGAGGCAGG + Intronic
950644170 3:14367296-14367318 GGGAGCTGGGGGGCGGGGGAGGG + Intergenic
950683820 3:14602708-14602730 GCGAGCTGCGGAGCGGAGCCTGG - Intergenic
951717390 3:25664263-25664285 GGTGGCTGCGGCGCGGGAGCCGG - Exonic
951780196 3:26354466-26354488 GGGGGCGGCGGAGCGGGGGCGGG - Intergenic
952644521 3:35639446-35639468 CGGAGCTGCGGGGAGGAGCCGGG + Intronic
952867199 3:37862021-37862043 GGGAGCTGGGGCGCGGGCCCGGG + Intronic
952889319 3:38030044-38030066 GGGAGCTGCGGCTGGAAGCCTGG - Intergenic
953003980 3:38960405-38960427 GGGAGGAGCGGCTTGGAGGCTGG + Intergenic
954389253 3:50260303-50260325 GGGGTCGGCGCCGCGGAGGCGGG + Intergenic
954539681 3:51385234-51385256 GGGAGCTACGGCGCGCGGCCGGG + Exonic
954895468 3:53971518-53971540 GGGAGCTGAGGCTCTGTGGCTGG + Intergenic
956813620 3:72888348-72888370 TGGCGCTGCGGGGCGGACGCGGG - Exonic
957215834 3:77317922-77317944 GGGGGCTGCGGCGCCAAGGCAGG + Intronic
959941653 3:112086992-112087014 GGGGGCTGCGGCGAGGTGGGTGG - Intronic
960120921 3:113948034-113948056 GGGAGCGGCCGAGCGGAGCCCGG + Exonic
961145968 3:124593597-124593619 TGGAGCTGGGGAGAGGAGGCAGG - Intronic
962575510 3:136752120-136752142 GGCGGCAGCGGCGCGGGGGCTGG - Intronic
963199686 3:142573341-142573363 GGAAGCTGTGGCACTGAGGCAGG + Intronic
963236757 3:142963736-142963758 GCGAGCCGAGGCGCGGAGGGAGG + Intergenic
966182237 3:177197669-177197691 GGGAGGGGCGCCGCGGACGCCGG + Intergenic
966696278 3:182793513-182793535 GGTGGCTGCGGCGCGGCGGCAGG + Exonic
966913402 3:184571603-184571625 GGGAGCTGGGGGGCACAGGCAGG - Intronic
967685276 3:192409903-192409925 GGAGGCGGCGGCGCGGCGGCGGG - Intronic
967840834 3:194003458-194003480 GGGAGCTGCAGGGCCGAGGCAGG - Intergenic
968230645 3:197003026-197003048 CGGGGCTGCGGGGAGGAGGCGGG + Exonic
968234376 3:197023071-197023093 GGCAGCTGCGTCCCGGGGGCAGG - Exonic
968293272 3:197555186-197555208 GGGCGCTGTGGCGCGGAGGGAGG + Intronic
968945452 4:3661225-3661247 AGGAGCTGGGGAGCGGAGGGTGG + Intergenic
969259041 4:6022141-6022163 GGGGGCTGAGGAGTGGAGGCCGG - Intergenic
969426539 4:7127773-7127795 GGGACCTGCGGCCCGAACGCGGG + Intergenic
969621464 4:8280935-8280957 GGGAGCTGCAGGGCAGAGGTGGG + Intronic
969703915 4:8781895-8781917 GGGCGCTGCGGGGCAGAGGTGGG + Intergenic
973916281 4:55637315-55637337 GGGAGGGGCGGTGCGGGGGCAGG - Intergenic
976273404 4:83252220-83252242 GGGAGCAGGGGGACGGAGGCTGG + Intergenic
976398437 4:84582717-84582739 AGGAGCTGGGAGGCGGAGGCGGG - Intergenic
979349266 4:119627302-119627324 ACGGGCGGCGGCGCGGAGGCCGG - Intronic
979468730 4:121071398-121071420 GGGAGCTGCGCAGCCGGGGCCGG - Intronic
981504125 4:145481799-145481821 GGCAGCTGAGGAGTGGAGGCTGG + Intronic
984206461 4:176792763-176792785 GGGCGCTGCGGCGGGGGCGCTGG + Intergenic
984756874 4:183332721-183332743 TGGGGCTGCGGCAGGGAGGCTGG + Intergenic
984762686 4:183376634-183376656 GGGAGCAGAGGCGAGGAGGAGGG - Intergenic
986679483 5:10220463-10220485 TGGAGATGCAGAGCGGAGGCTGG - Intergenic
987123016 5:14785282-14785304 GGGAGCTGAGGCCTGGAGGGAGG + Intronic
988547650 5:32173764-32173786 GGGGGCGGCGGCGCGGGGCCCGG - Intronic
990910012 5:60843793-60843815 GCGCGCTGCGGAGCGGAGCCTGG - Intronic
992080348 5:73230591-73230613 CGGGGCTGGAGCGCGGAGGCTGG + Intergenic
992124312 5:73625863-73625885 GAGATCGGAGGCGCGGAGGCTGG - Intergenic
992124495 5:73626470-73626492 AGGCGCTGCGGCGCGAGGGCTGG + Intronic
992487516 5:77210632-77210654 GGGCGCCGCGGCGGGGAGGGTGG + Intronic
992837487 5:80654932-80654954 GGCAGCTGGGGCGGGAAGGCGGG - Exonic
995675652 5:114659686-114659708 GGGAGCTGTGGCGCTGTGGGGGG + Intergenic
997454048 5:134004686-134004708 GGGGGCTGCGACGCGGAGGCAGG + Intronic
997964280 5:138345363-138345385 GGGAGAAGCGGCGCTGAGGTGGG - Exonic
998133163 5:139661150-139661172 GGCAGCCGCGGCGGGGAGGCTGG - Intronic
998377650 5:141701869-141701891 GGGAGCAGCGAGGGGGAGGCAGG + Intergenic
999936671 5:156494100-156494122 GGGAGCTGGGGCCTGGAGGATGG + Intronic
1000014689 5:157266434-157266456 CGGAGCTCCGGCGCGGCGGCGGG + Intronic
1002068616 5:176665173-176665195 GGGGGATGCGGCGCGGAGGCGGG + Intergenic
1002665076 5:180817091-180817113 GGGAGGGGCGGCAGGGAGGCAGG + Intergenic
1003058219 6:2841775-2841797 CGGAGCGGTGGCGCGGGGGCGGG - Intronic
1003290680 6:4776287-4776309 GGGAGGGGCGGGGCGGCGGCGGG - Intronic
1003544904 6:7051443-7051465 GGCGGCTGCGGCGCGGAGCCGGG + Intergenic
1003872166 6:10412230-10412252 GGGGGCCGCGGCGCGGCGTCTGG + Intronic
1004469920 6:15920178-15920200 GGGAGCTGCAGGGAGGAAGCCGG + Intergenic
1004635951 6:17467940-17467962 GGGAGCTGAGGCGGGGAGGTGGG - Intronic
1005040455 6:21595619-21595641 GGGCGAGGCGGCGCGCAGGCTGG - Exonic
1005348339 6:24911135-24911157 GGGAGGCGCGGCGCGGGGGCCGG + Intronic
1005385284 6:25279408-25279430 TGTAGGTGCGGCGCGGAGGCTGG + Exonic
1005940567 6:30556611-30556633 GGGGGCGGCGGAGCGGAGGGCGG + Exonic
1007363217 6:41373202-41373224 CGCAGCTCCGGCGCGGGGGCTGG - Intergenic
1007431578 6:41780116-41780138 CGGAGGCGGGGCGCGGAGGCGGG + Intronic
1011419501 6:87156139-87156161 GGAAGCAGAGGCGCAGAGGCGGG - Intronic
1013273186 6:108560827-108560849 GGGACCTGCGGCTGGGCGGCGGG + Intronic
1013429582 6:110043728-110043750 GGGAGCTGGGGCGGGGGTGCTGG - Intergenic
1013524139 6:110958904-110958926 GGGAGCTGCGGGCCGGAGGGAGG + Intronic
1014272587 6:119349981-119350003 GGGAGCCGCGGTGAGGAGGACGG + Intergenic
1015315061 6:131808063-131808085 GGGAGCCGCGGCGGCGAGGGCGG + Exonic
1015843866 6:137497832-137497854 GCGGGCTGCGCCGCGGAGGCGGG + Intergenic
1016183496 6:141175096-141175118 GAGAGGTGCGGGGGGGAGGCAGG + Intergenic
1016714097 6:147204076-147204098 GCGAGCAGCGGCGCGGCCGCGGG + Intergenic
1018326196 6:162671961-162671983 GGGAGGTGCTGCGGGGAGGATGG + Intronic
1019198461 6:170295981-170296003 AGGAGCCGCGGCGCAGAGGAGGG - Intronic
1019258067 7:64292-64314 GGGAGCTGCAGTGCAGGGGCAGG + Intergenic
1019304719 7:327840-327862 GGGAGCCGTGGCGGGCAGGCGGG - Intergenic
1019324618 7:432072-432094 AGCAGCTGTGGGGCGGAGGCGGG + Intergenic
1019343769 7:520069-520091 CGGAGCCCCGGCGCGGAGCCGGG - Intronic
1019409294 7:899662-899684 GGGAGGTGCCGTGTGGAGGCTGG - Intronic
1019597932 7:1866955-1866977 GGGAGGTGCAGCTCGGAGGTAGG + Intronic
1019984036 7:4642132-4642154 GGGAGCTGCCGCGCCGGGGCCGG - Intergenic
1020005746 7:4783099-4783121 GGGAGCTGCATCGCTGAGGCTGG - Intronic
1020238467 7:6374468-6374490 GGGAGCGGCGGCGCCGGCGCGGG + Intergenic
1020274325 7:6615593-6615615 GGGGGCGGGGGCGCGGGGGCCGG - Intergenic
1020278204 7:6637238-6637260 GGGGGCAGCGGCGCGGAGCGGGG - Intergenic
1022007377 7:26278260-26278282 GGGAGGCGGGGCGCTGAGGCAGG + Intergenic
1022104003 7:27185607-27185629 GGGAGCTGCGGGTGGGAGGTGGG - Intergenic
1022187008 7:27979696-27979718 GGGAGCTGCAGGGCAAAGGCAGG - Intronic
1022375273 7:29806582-29806604 GGGCGCTGCGGGACGGAGCCCGG + Exonic
1022722976 7:32957408-32957430 TGGAGCTGCGGCCGGGAGGGCGG + Exonic
1022739740 7:33109497-33109519 GTGAGTTGCGGGGCGGCGGCGGG - Intergenic
1024085541 7:45889040-45889062 GGGAGGTGCCGGGCGGGGGCGGG - Intronic
1024973149 7:55088832-55088854 GGGAGATGAGGCAGGGAGGCTGG - Intronic
1024974659 7:55102098-55102120 GGGACCTGCAGGGCAGAGGCAGG - Intronic
1025729996 7:64100456-64100478 GGGAGCTGCGGGGCAGGGGCGGG + Intronic
1026023474 7:66728069-66728091 GGGTGATGAGGAGCGGAGGCAGG - Intronic
1026061693 7:67032294-67032316 GGGAGCAGCTGCGGGGAGGCAGG + Intronic
1026716655 7:72795140-72795162 GGGAGCAGCTGGGGGGAGGCAGG - Intronic
1026796479 7:73369140-73369162 AGGAGCTGCTGCCAGGAGGCAGG - Intergenic
1026840435 7:73667778-73667800 AGGAGCCGCGGCGCCGGGGCTGG - Intergenic
1026888272 7:73967260-73967282 GGGTGATGAGGAGCGGAGGCAGG - Intergenic
1026909411 7:74083756-74083778 GTGAGCTGCGGCACGGGGGCGGG - Intronic
1027177786 7:75915495-75915517 GGGGGCGGCGGCGCGGGGACTGG - Intronic
1028135593 7:87220224-87220246 GGGAGCTGCGGCGAGCACGCCGG - Intronic
1028565670 7:92228016-92228038 GGGGGTTGCGGCGGGGAGGTGGG + Intronic
1029161370 7:98554744-98554766 GGGAGAGGAGGCGGGGAGGCAGG - Intergenic
1029483804 7:100827463-100827485 GGAGACTGCGGCGCGGAGCCGGG + Exonic
1029639886 7:101814321-101814343 CGGAGCTACAGCGCGGCGGCCGG + Intergenic
1032079447 7:128851365-128851387 GGGAGCTGCAGGTCGCAGGCTGG + Intronic
1034192723 7:149224075-149224097 GGGGGCGGCGGCGCGGAGGCGGG + Exonic
1034426429 7:151016602-151016624 GGGAGCTGGGGCGCTGAGGGGGG - Intronic
1034498357 7:151435123-151435145 GGGAGCTTCGGAGGGGATGCAGG - Intronic
1034870530 7:154679431-154679453 GGGAACTGCGGACCGGATGCAGG - Intronic
1035022590 7:155808329-155808351 GGGAGCTGCGGTGGGGTGGGGGG - Intronic
1035375615 7:158404932-158404954 GGGAGCTGGGGAGCTGGGGCCGG - Intronic
1035764854 8:2097962-2097984 GGGAGCTGAGGGGCGGGTGCCGG - Intronic
1036708078 8:11059736-11059758 GGGAGCCGCGGGGCGGGGTCCGG - Intronic
1036723768 8:11201245-11201267 GGCAGCGGCGGCGAGGAGGACGG - Exonic
1036723946 8:11201781-11201803 GTGAGCTGCGACGCTGAGGAAGG - Intergenic
1038304155 8:26383611-26383633 GGGACGTGCGGCGGGGACGCCGG + Intronic
1038575590 8:28701432-28701454 GCGAGCGGGGGCGCGGACGCGGG - Exonic
1038727702 8:30095727-30095749 GGGGGCTGCGGGGCGAAGCCGGG - Intronic
1042591590 8:70403014-70403036 GGGAGCCGCGGCCCGGCGGGTGG - Intronic
1042837792 8:73093200-73093222 GGGAGGGGCGGCGCGGAGGGCGG - Exonic
1043012584 8:74899891-74899913 GGGAACTGCTGCAAGGAGGCTGG - Intergenic
1043372688 8:79612186-79612208 GGAAGCCGCGGCGGGGAGTCGGG - Intronic
1044591605 8:93917786-93917808 GGAGGCGGCGGCGGGGAGGCGGG - Intronic
1047000546 8:120568570-120568592 GGGAGCTGGGGTGATGAGGCTGG + Intronic
1047104811 8:121720453-121720475 GCCAGCTGCAGCGGGGAGGCGGG - Intergenic
1048981189 8:139703966-139703988 CGGAGCAGCGGGGCGGACGCGGG + Intergenic
1049093932 8:140536789-140536811 GGGGGCTGCAGCGGGGAGGAAGG + Intronic
1049386546 8:142345636-142345658 GGGAGCTGCAGGGAGGAGGCTGG - Intronic
1049417131 8:142500328-142500350 GGGAGGAGCGGCGCGGGGGGCGG - Intronic
1049756555 8:144313636-144313658 GGGAGGCGGGGCGGGGAGGCGGG - Intronic
1049756562 8:144313649-144313671 GGGCGGCGCGGCGGGGAGGCGGG - Intronic
1049756571 8:144313670-144313692 GGGAGGCGGGGCGGGGAGGCGGG - Intronic
1049756591 8:144313712-144313734 GGGAGGCGGGGCGGGGAGGCGGG - Intronic
1049756606 8:144313743-144313765 GGGAGGCGGGGCGGGGAGGCGGG - Intronic
1049756617 8:144313764-144313786 GGGAGGCGGGGCGGGGAGGCGGG - Intronic
1049756624 8:144313777-144313799 GGGAGGCGGGGCGGGGAGGCGGG - Intronic
1049896241 9:113910-113932 GGGGGCGGCGGCGCAGAGGCCGG + Intergenic
1051483118 9:17579728-17579750 GGGGGTGGCGGGGCGGAGGCCGG + Intronic
1053154916 9:35770814-35770836 GGGAGATGCTTAGCGGAGGCTGG - Intergenic
1055032349 9:71783367-71783389 GGGAGCTGACGCACGGAGGGTGG + Intronic
1057221893 9:93261942-93261964 GGGAGCTGGGGAACTGAGGCAGG - Exonic
1057441953 9:95089756-95089778 GGGAGCTGCTGAGCTGAGGCTGG - Intergenic
1057922035 9:99105303-99105325 GTGAGCGGCGGCGCGGCGGGCGG + Intronic
1058005141 9:99906580-99906602 GGGCCCTGCGGGGCGGGGGCGGG + Intergenic
1059414991 9:114156750-114156772 CGGAGCTGGGGCCCAGAGGCTGG + Intronic
1059942261 9:119369538-119369560 GGGAGCGGCGGCCGGGGGGCGGG + Intergenic
1060544747 9:124453341-124453363 GGGAGCAGCGGGGCGGGCGCTGG + Exonic
1060544761 9:124453387-124453409 GCGCGCTGGGGCGCGGGGGCTGG + Exonic
1061038670 9:128127519-128127541 GGGAGCTGCGGCGCTGGCCCTGG - Exonic
1061293401 9:129665171-129665193 GGGAGCAGCGGGGGAGAGGCGGG + Intergenic
1061384949 9:130284319-130284341 GGGAGCTGCTGTCCGGAGGGAGG + Intergenic
1061412163 9:130427624-130427646 GGGAGCTGCCGGGAGGAGGGAGG + Intronic
1061413116 9:130431602-130431624 GTGAGGTGGGGCGGGGAGGCAGG + Intronic
1061541020 9:131277834-131277856 GGCGGCAGCGGCGCGGCGGCGGG - Intergenic
1061587557 9:131578725-131578747 GGGAGCTGAGAAGAGGAGGCTGG - Exonic
1061898089 9:133658840-133658862 GGGAGCAGCGGGGCGGGGGCGGG - Exonic
1061914228 9:133740985-133741007 TGGAGCGGTGGCGGGGAGGCTGG - Intergenic
1062162397 9:135087623-135087645 GGGGGCCGCGGCCGGGAGGCGGG - Intronic
1062325693 9:136011542-136011564 GGCGGCCGCGGCCCGGAGGCCGG - Exonic
1062624001 9:137434856-137434878 GGCAGCTGCGTCCCGGATGCTGG - Exonic
1203771688 EBV:52931-52953 GGCGGCGGCGGCGCTGAGGCGGG + Intergenic
1187419359 X:19121908-19121930 CGGAGCGGCGGCCCGGAGCCAGG - Intronic
1187685694 X:21813624-21813646 GGGAGCTGCCTGGCAGAGGCTGG + Intergenic
1188006751 X:25020988-25021010 GGGGGCTGAGGTGGGGAGGCTGG - Intergenic
1190024661 X:46912529-46912551 GGGAGCTGAGGCGCGGGGGGCGG + Exonic
1191834112 X:65445785-65445807 GGGAGCTGGGGCTAGGAGTCGGG + Intronic
1192363556 X:70453762-70453784 GGGAGCTGCGCAGGGGAGACCGG + Exonic
1192780984 X:74293603-74293625 GGGAGGCGGGGCGCGGAGGGGGG - Intergenic
1192795453 X:74421494-74421516 GCCAGCTGGGGCGCGGAGCCTGG + Exonic
1193391011 X:80929432-80929454 AGGGGCTGCAGCGCGGAGGCAGG - Intergenic
1196456027 X:115892299-115892321 GGGAGCTGCGACTCAGAGTCAGG - Intergenic
1196683933 X:118495362-118495384 GGGCACTGCAGCTCGGAGGCGGG + Intergenic
1198099847 X:133414514-133414536 GGGAGAGGAGGAGCGGAGGCGGG + Intronic
1199736790 X:150693321-150693343 GGGAGCGGGGGCGGGGAGGGCGG - Intronic
1200177189 X:154125475-154125497 GGCTGCTGCGGAGCGGGGGCTGG - Intergenic