ID: 900115406

View in Genome Browser
Species Human (GRCh38)
Location 1:1025878-1025900
Sequence CCCAACCCCGGGGCTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900115398_900115406 -9 Left 900115398 1:1025864-1025886 CCACCTCTGTCCATCCCAACCCC 0: 1
1: 0
2: 6
3: 80
4: 727
Right 900115406 1:1025878-1025900 CCCAACCCCGGGGCTCCTGGTGG 0: 1
1: 0
2: 3
3: 40
4: 323
900115396_900115406 4 Left 900115396 1:1025851-1025873 CCGGGTGAAGGGCCCACCTCTGT 0: 1
1: 0
2: 0
3: 16
4: 222
Right 900115406 1:1025878-1025900 CCCAACCCCGGGGCTCCTGGTGG 0: 1
1: 0
2: 3
3: 40
4: 323
900115397_900115406 -8 Left 900115397 1:1025863-1025885 CCCACCTCTGTCCATCCCAACCC 0: 1
1: 0
2: 1
3: 66
4: 567
Right 900115406 1:1025878-1025900 CCCAACCCCGGGGCTCCTGGTGG 0: 1
1: 0
2: 3
3: 40
4: 323
900115391_900115406 27 Left 900115391 1:1025828-1025850 CCTGGAGCTGGGAGGGGGGTCTG 0: 1
1: 0
2: 4
3: 90
4: 680
Right 900115406 1:1025878-1025900 CCCAACCCCGGGGCTCCTGGTGG 0: 1
1: 0
2: 3
3: 40
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900115406 Original CRISPR CCCAACCCCGGGGCTCCTGG TGG Intronic