ID: 900116991

View in Genome Browser
Species Human (GRCh38)
Location 1:1033181-1033203
Sequence GGCGCCCCCGACTCCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 173}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900116991_900117001 18 Left 900116991 1:1033181-1033203 CCCGCGCGGGAGTCGGGGGCGCC 0: 1
1: 0
2: 2
3: 16
4: 173
Right 900117001 1:1033222-1033244 TGTCAATCCCCAGGGGAAAGTGG 0: 1
1: 0
2: 2
3: 19
4: 229
900116991_900116999 11 Left 900116991 1:1033181-1033203 CCCGCGCGGGAGTCGGGGGCGCC 0: 1
1: 0
2: 2
3: 16
4: 173
Right 900116999 1:1033215-1033237 GAGCCACTGTCAATCCCCAGGGG 0: 1
1: 0
2: 1
3: 4
4: 142
900116991_900117003 24 Left 900116991 1:1033181-1033203 CCCGCGCGGGAGTCGGGGGCGCC 0: 1
1: 0
2: 2
3: 16
4: 173
Right 900117003 1:1033228-1033250 TCCCCAGGGGAAAGTGGGCGAGG 0: 1
1: 0
2: 0
3: 27
4: 248
900116991_900116998 10 Left 900116991 1:1033181-1033203 CCCGCGCGGGAGTCGGGGGCGCC 0: 1
1: 0
2: 2
3: 16
4: 173
Right 900116998 1:1033214-1033236 GGAGCCACTGTCAATCCCCAGGG 0: 1
1: 0
2: 1
3: 11
4: 127
900116991_900117002 19 Left 900116991 1:1033181-1033203 CCCGCGCGGGAGTCGGGGGCGCC 0: 1
1: 0
2: 2
3: 16
4: 173
Right 900117002 1:1033223-1033245 GTCAATCCCCAGGGGAAAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 131
900116991_900116997 9 Left 900116991 1:1033181-1033203 CCCGCGCGGGAGTCGGGGGCGCC 0: 1
1: 0
2: 2
3: 16
4: 173
Right 900116997 1:1033213-1033235 AGGAGCCACTGTCAATCCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900116991 Original CRISPR GGCGCCCCCGACTCCCGCGC GGG (reversed) Intronic