ID: 900118140

View in Genome Browser
Species Human (GRCh38)
Location 1:1037224-1037246
Sequence CTGGATTTAAAGAGGTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900118132_900118140 6 Left 900118132 1:1037195-1037217 CCACCTGTGAGCCAGAGGCCTGG 0: 1
1: 1
2: 4
3: 41
4: 331
Right 900118140 1:1037224-1037246 CTGGATTTAAAGAGGTGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 155
900118129_900118140 29 Left 900118129 1:1037172-1037194 CCAGGGCAAGAACTGCGTTTCCA 0: 1
1: 0
2: 0
3: 16
4: 116
Right 900118140 1:1037224-1037246 CTGGATTTAAAGAGGTGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 155
900118134_900118140 3 Left 900118134 1:1037198-1037220 CCTGTGAGCCAGAGGCCTGGAGC 0: 1
1: 0
2: 0
3: 32
4: 304
Right 900118140 1:1037224-1037246 CTGGATTTAAAGAGGTGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 155
900118131_900118140 9 Left 900118131 1:1037192-1037214 CCACCACCTGTGAGCCAGAGGCC 0: 1
1: 0
2: 1
3: 28
4: 258
Right 900118140 1:1037224-1037246 CTGGATTTAAAGAGGTGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 155
900118136_900118140 -5 Left 900118136 1:1037206-1037228 CCAGAGGCCTGGAGCCAACTGGA 0: 1
1: 0
2: 6
3: 27
4: 240
Right 900118140 1:1037224-1037246 CTGGATTTAAAGAGGTGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900118140 Original CRISPR CTGGATTTAAAGAGGTGCTC AGG Intronic
900118140 1:1037224-1037246 CTGGATTTAAAGAGGTGCTCAGG + Intronic
900248489 1:1652342-1652364 CTGGTTTTTCAGTGGTGCTCTGG + Intronic
900259628 1:1719231-1719253 CTGGTTTTTCAGTGGTGCTCTGG + Intronic
901690600 1:10970660-10970682 CTGTATTTTAACAAGTGCTCAGG - Intronic
902793774 1:18787034-18787056 TTAGATTTCTAGAGGTGCTCAGG - Intergenic
905541874 1:38766359-38766381 CTGAATTTCAAGAGGTTCTCGGG + Intergenic
905721735 1:40209166-40209188 CTGGATTTACTGAGGAGCTTAGG + Intronic
906132851 1:43471501-43471523 CTGCATTTAAAAAGATCCTCAGG - Intergenic
906787650 1:48629977-48629999 CTGGCTGTAAGCAGGTGCTCAGG - Intronic
907316921 1:53578033-53578055 CCTGCTTTAAGGAGGTGCTCAGG - Intronic
907938594 1:59065410-59065432 CTGCATTTTAACAGATGCTCAGG + Intergenic
910601104 1:89033597-89033619 CTGGAAGAGAAGAGGTGCTCTGG + Intergenic
915144786 1:153790087-153790109 CTGATCTTAAAGAGGTGCTCCGG - Intergenic
916881879 1:169026781-169026803 TTGTTTTTAAAGAGGGGCTCAGG + Intergenic
916977478 1:170096651-170096673 CTGGGTTTAAATATGGGCTCTGG - Intergenic
917312718 1:173693493-173693515 CTGGCTTTAAAGCTGTGTTCTGG - Intergenic
917339994 1:173966272-173966294 CTGGGTTTAAAGAGATGCTGTGG + Intronic
917789847 1:178492501-178492523 CTGGCTTTGGAGAGGTGGTCAGG + Intergenic
918026029 1:180747307-180747329 CTGGCTTTCAGAAGGTGCTCAGG + Intronic
918145614 1:181753260-181753282 CTGGATTTTAAGAAGTACCCAGG - Intronic
919774508 1:201185364-201185386 CTGGGTTCTAAGAGTTGCTCAGG + Intergenic
919904541 1:202069105-202069127 CTGGATTTAGTGAGGATCTCAGG + Intergenic
922189939 1:223309483-223309505 CTGGGCTTGAAGTGGTGCTCAGG + Intronic
922916476 1:229262065-229262087 CTGAATTTATAGAAGTGCTCTGG + Intergenic
924430525 1:243992552-243992574 GTGGATTTAGGGTGGTGCTCAGG + Intergenic
1068026352 10:51650151-51650173 CTGGTATTCACGAGGTGCTCAGG + Intronic
1069643107 10:69969189-69969211 GTTGATTTAAAGAGATGTTCTGG + Intergenic
1070963293 10:80514310-80514332 CTGCATTTAAAGAGGTGGGATGG + Intronic
1072546132 10:96440978-96441000 CTGCATTTGAAGAGGAGCTCAGG + Intronic
1073946048 10:108751820-108751842 ATGGATTGAAAGAGGTGCTGAGG + Intergenic
1074880461 10:117653161-117653183 TTTGATTTCAAGATGTGCTCAGG + Intergenic
1075230129 10:120669162-120669184 CAGGATTTTAAAAGATGCTCAGG + Intergenic
1076711266 10:132336104-132336126 CTGCATTTCCAGAGGTGCTGGGG + Intronic
1077332759 11:1990584-1990606 CTGGAGGCAAAGAGGTGCCCGGG - Intergenic
1077906955 11:6542010-6542032 CTGGATATAAAGAGGTGATAAGG - Intronic
1078187179 11:9061986-9062008 GTGGAGTTAAGGAGGAGCTCTGG - Intronic
1080789645 11:35510817-35510839 CTGATTTTAAAGAGGGGATCAGG - Intronic
1080997826 11:37625955-37625977 CTGGATGTAAAGAGGTAGTGTGG + Intergenic
1082888285 11:58111276-58111298 CTGAATTTAAGGAGATGCTCAGG + Intronic
1084291926 11:68177398-68177420 CTGGATTCAAAGAGTTGACCAGG + Intronic
1084549943 11:69835180-69835202 CTGGCTTTAAAAAGATGCTGCGG + Intergenic
1088838489 11:113601919-113601941 CTGAATTTATAGATGTACTCAGG - Intergenic
1088852128 11:113713722-113713744 TTGGAGTGGAAGAGGTGCTCTGG + Intergenic
1089025817 11:115268773-115268795 CTGACTCTAAAGAGGGGCTCAGG - Intronic
1202815742 11_KI270721v1_random:45760-45782 CTGGAGGCAAAGAGGTGCCCGGG - Intergenic
1091711425 12:2743294-2743316 TGGGATTTAAAGAGGTCTTCTGG - Intergenic
1095716815 12:45355414-45355436 CTGTATTTAAAGAGCTGGTCAGG - Intronic
1097558369 12:61168547-61168569 CTGGCTTTCAAGAGGTGATTGGG + Intergenic
1100218637 12:92479952-92479974 CTGGATCTAAGGAGGAACTCAGG + Intergenic
1101695479 12:107121861-107121883 CTGGATTTTACAAGGTGCCCAGG - Intergenic
1102171743 12:110847714-110847736 CTGGAATTAAACATGTGCTTAGG - Intronic
1102246855 12:111361677-111361699 CTGGAGCTGAAGAGGGGCTCTGG + Exonic
1103921775 12:124403029-124403051 CTGGGTTGAGAGAGGTGCCCTGG + Intronic
1104902519 12:132197153-132197175 CTGGTGGTACAGAGGTGCTCGGG - Exonic
1107660576 13:42635197-42635219 CTGGGTTTAGAGTGGGGCTCAGG - Intergenic
1110153355 13:72282605-72282627 CTGGATTTAAAGACGTTGTCAGG + Intergenic
1110235564 13:73214360-73214382 CTGAAATTGGAGAGGTGCTCCGG + Intergenic
1112798290 13:103081744-103081766 CTGGATTTTGACAGGTGCTTTGG + Intergenic
1114080783 14:19200337-19200359 CTGGTTGTAGAGAGGAGCTCTGG - Intergenic
1116784927 14:49277175-49277197 CTGGATTTTAAGAGCTCCCCAGG - Intergenic
1119596962 14:75943979-75944001 ATGGATTTAAAGAAATGATCTGG + Intronic
1123088472 14:105730488-105730510 CTGGACTCAAAGAGGTGGTGTGG + Intergenic
1125409817 15:39394242-39394264 CTGGATGTACACAGGTGCTGAGG - Intergenic
1126412240 15:48384282-48384304 CTGAACTTCAAGAGGTCCTCCGG + Intergenic
1126419540 15:48456964-48456986 CTGGATTTAAATATATGTTCTGG + Intronic
1130766826 15:86879322-86879344 ATGGTTATAAAGAGCTGCTCAGG + Intronic
1130811737 15:87386191-87386213 CTGAATTTAAAGATGTGATATGG - Intergenic
1132384975 15:101393842-101393864 CTGGGTTGAAAGAGCTGGTCTGG + Intronic
1133536537 16:6707718-6707740 CTGGAATTAAAAATGTGCTATGG - Intronic
1133677985 16:8093547-8093569 ATGGATTTAAAGACTTTCTCAGG + Intergenic
1139776163 16:69318335-69318357 CTGGACTTAAAGAGCAGCCCAGG - Intronic
1141380689 16:83573964-83573986 CGGGATTTAAAGAGGAGATGAGG + Intronic
1142881464 17:2885409-2885431 CTGGATGAACTGAGGTGCTCAGG - Intronic
1149008759 17:51833077-51833099 CTGAATTTAAAGAGGCCCTCTGG + Intronic
1149195431 17:54113801-54113823 CTGAATTTAAAGCTGGGCTCTGG + Intergenic
1152344699 17:79743879-79743901 CTGGATTTACAGAGGAGGACAGG - Intergenic
1152585809 17:81188990-81189012 CTGGGTGTGAAGAGATGCTCTGG + Intergenic
1157518740 18:48330196-48330218 CAGGATTTAAAGACATGCTGGGG - Intronic
1163131967 19:15279829-15279851 CTGGGTTTCAAGAGGTCCGCTGG - Intronic
1166264205 19:41667491-41667513 CTAGTTTTAAAGAGGATCTCAGG - Intronic
926648668 2:15317326-15317348 TTGGAGGAAAAGAGGTGCTCTGG - Intronic
927940899 2:27102238-27102260 CTGGATTAGAAGAGGTGCCGGGG + Intronic
928364532 2:30691124-30691146 CTGGACTAAAGGAGGTGTTCAGG - Intergenic
932243290 2:70174970-70174992 CAGGATTTAAAGAGGGGGTTGGG - Intronic
933741454 2:85537925-85537947 CCGGGTTTAATGAGGTTCTCAGG - Intergenic
934163347 2:89272707-89272729 CTAGGGTTAAAGAGGTGATCAGG - Intergenic
934203927 2:89909817-89909839 CTAGGGTTAAAGAGGTGATCAGG + Intergenic
935196916 2:100821359-100821381 CTGGAGTTCAACAGGTGTTCAGG + Intronic
937804289 2:126120236-126120258 CTGGATCAAAATAGGAGCTCCGG + Intergenic
940267472 2:151854285-151854307 ATGGATTGAAAGAGCTGCTGGGG - Intronic
940279371 2:151973728-151973750 TTGCCTTGAAAGAGGTGCTCTGG - Intronic
943435582 2:187862052-187862074 ATGGATTTAGTCAGGTGCTCAGG + Intergenic
944530204 2:200660305-200660327 CTGGATTAAAACAGGAGTTCTGG - Intronic
946794168 2:223331570-223331592 TTGGAGGAAAAGAGGTGCTCTGG - Intergenic
948453466 2:238093032-238093054 CTGGATAGCAAGAGGTGCCCAGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173006059 20:39140612-39140634 CTGGATGTAAAGTGGTTCTAGGG + Intergenic
1174223972 20:48982046-48982068 TTGGAGGAAAAGAGGTGCTCTGG + Intronic
1177274602 21:18893070-18893092 CTAGATTTAAATTGATGCTCTGG + Intergenic
1178932971 21:36835654-36835676 CTGGATTGGGAGAGGTGCCCAGG - Intronic
1180499990 22:15922348-15922370 CTGGCTGTAGAGAGGAGCTCTGG + Intergenic
1181785483 22:25223758-25223780 CTGGATGAAAAGATGGGCTCAGG - Intronic
1184333738 22:43841347-43841369 CTGGAACTAAAGAGGTGCAGCGG + Intronic
949667115 3:6352502-6352524 CATGATATAAAGAGGTGCTTTGG + Intergenic
950633374 3:14298778-14298800 GTGGATTAAAAGTGGGGCTCAGG + Intergenic
955021880 3:55129875-55129897 CAGGGTGTAAAGAGGTGCTTTGG - Intergenic
956725281 3:72151817-72151839 CTGGATTTTTAAAGCTGCTCTGG - Intergenic
956955984 3:74340551-74340573 CTTGATTTATAGTGTTGCTCCGG + Intronic
962511570 3:136106073-136106095 CAGGTTTAAAAGAGGTGCTAAGG - Intronic
965107458 3:164375656-164375678 CAGTATTTAAAAAGTTGCTCAGG + Intergenic
969426919 4:7129901-7129923 CTGGATTTAAAGGAGAGCCCTGG + Intergenic
970131240 4:12874401-12874423 CTTTATTTGAAGAGGAGCTCAGG - Intergenic
971414359 4:26410102-26410124 CTGGATTCAGAGAAGTGTTCTGG + Intronic
979670053 4:123352151-123352173 CTGGATTTATAGGGAAGCTCAGG - Intergenic
981662629 4:147184945-147184967 CTGGATGAGAAGAGGTGTTCTGG - Intergenic
982698447 4:158631229-158631251 ATGGATTTAAAATGGTGCACTGG - Intronic
985926373 5:3022815-3022837 CTGTGTGTAAAGGGGTGCTCGGG + Intergenic
989091388 5:37736726-37736748 CTGAATATTAAGAGGTGCCCTGG + Intronic
989994840 5:50817484-50817506 GTGCATTTTAAGTGGTGCTCTGG + Intronic
992256616 5:74927578-74927600 CTTAATTAACAGAGGTGCTCTGG + Intergenic
992965779 5:81998362-81998384 CTGCATTACAAGAGGTGCTGAGG + Intronic
998614731 5:143727567-143727589 GTGGAGGTAAAGGGGTGCTCTGG + Intergenic
999521577 5:152356393-152356415 CTGAATTTGAAGAGCTGCTTTGG + Intergenic
999638074 5:153643125-153643147 CTGGATTTGAAAAAGTGCACTGG + Intronic
1000033706 5:157425403-157425425 TTGGATGAGAAGAGGTGCTCTGG - Intronic
1001283634 5:170406530-170406552 CTGAATTTAAAAAGTGGCTCAGG + Intronic
1001734431 5:173987460-173987482 ATGAATTTAAAGAGATGGTCGGG + Intronic
1002849698 6:982798-982820 CTGGCTTAAAAGAGGTGCAGTGG + Intergenic
1003397230 6:5763828-5763850 CAGGATTTAAATAAGTGGTCTGG - Intronic
1005109419 6:22263537-22263559 CTGGATTTCAAGTGATACTCAGG + Intergenic
1005484509 6:26286699-26286721 CTGGAATTAAAGAAATACTCGGG - Intergenic
1015304946 6:131697064-131697086 CTGGCTTTAAAAAGGTGCTCAGG - Intronic
1017661612 6:156679469-156679491 CTGGATTTCAAGAGTTGTTATGG - Intergenic
1018354689 6:163000544-163000566 CTGGATTTAAACTGTAGCTCTGG + Intronic
1019051246 6:169185441-169185463 CTGAAATGAAAGAGGTGCACAGG + Intergenic
1019058770 6:169241199-169241221 CTGAACATAATGAGGTGCTCCGG - Intronic
1020344079 7:7144660-7144682 TTGGAGGAAAAGAGGTGCTCTGG + Intergenic
1028478907 7:91282999-91283021 CTGGATTTCATGAGGGGCTGAGG - Intergenic
1029170304 7:98625450-98625472 CTGGATTGAGAGAGGACCTCAGG + Intronic
1039715785 8:40107279-40107301 CTGAATTTAATGGGGTGGTCAGG - Intergenic
1042443434 8:68854508-68854530 CGAGATGTAAAGAGGTTCTCAGG + Intergenic
1042892617 8:73629720-73629742 CTGGAATTATACAGATGCTCTGG + Intronic
1044956515 8:97487194-97487216 TTGGAGGAAAAGAGGTGCTCTGG + Intergenic
1045335476 8:101199632-101199654 CTAATTGTAAAGAGGTGCTCAGG + Intronic
1045499546 8:102734708-102734730 GTGGATTTACACTGGTGCTCAGG + Intergenic
1045661910 8:104446851-104446873 CTGGATATTAAAATGTGCTCTGG - Intronic
1046866052 8:119151638-119151660 ATGGTTTTAAAGAGGTCCTATGG - Intergenic
1047679357 8:127238154-127238176 CTGGATTTAAAATGTGGCTCAGG - Intergenic
1048103120 8:131377252-131377274 TTGGTTTTAAAGAGATGCACAGG - Intergenic
1048218805 8:132522119-132522141 GTGGATTTATAGAGATTCTCAGG - Intergenic
1049095603 8:140546422-140546444 CTGGGGTTCAAGAGCTGCTCAGG + Intronic
1054334159 9:63788332-63788354 TTGGAAGAAAAGAGGTGCTCTGG - Intergenic
1057930613 9:99189966-99189988 CTGAATTTAAAGAAGTGATTTGG + Intergenic
1060732863 9:126049175-126049197 CTGGACTTAACGAGGTGAGCAGG + Intergenic
1062373688 9:136252673-136252695 CTGGAACTACAGAGGTGCACAGG - Intergenic
1186820027 X:13278377-13278399 ATGGATTTAAACACTTGCTCTGG - Intergenic
1187140880 X:16592476-16592498 CTGGATCTAGGGAGGTGCTGTGG - Intronic
1187906665 X:24072848-24072870 CAGAATTTTAAGAGGTACTCTGG + Intronic
1188456766 X:30375261-30375283 GTGAATTTAAATAGGTGTTCTGG - Intergenic
1190550121 X:51571122-51571144 CTGGACATAAAGAAGTGATCTGG + Intergenic
1192847502 X:74921646-74921668 TTGGGTTTGAAAAGGTGCTCTGG + Intronic
1193940825 X:87679345-87679367 CTAGAATTACAGAGATGCTCTGG + Intergenic
1194365795 X:93012057-93012079 CTTGTTTTATGGAGGTGCTCTGG + Intergenic
1196908138 X:120459085-120459107 CTGGATTAAAGGGTGTGCTCTGG - Intronic
1198083744 X:133263845-133263867 CTGGGTTCAAATATGTGCTCTGG + Intergenic
1200674017 Y:6128304-6128326 CTTGTTTTATGGAGGTGCTCTGG + Intergenic
1201686839 Y:16714240-16714262 CTGGAATTAAAGAAATACTCTGG - Intergenic
1201927185 Y:19300045-19300067 CTGGAGTTAAGGATGTGCCCAGG + Intergenic