ID: 900118714

View in Genome Browser
Species Human (GRCh38)
Location 1:1039633-1039655
Sequence GTGGCCAACAAAGCTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900118714_900118719 -4 Left 900118714 1:1039633-1039655 CCTGAGGCAGCTTTGTTGGCCAC 0: 1
1: 0
2: 1
3: 11
4: 160
Right 900118719 1:1039652-1039674 CCACGTTGAGGTCTGGTGATGGG 0: 1
1: 0
2: 0
3: 2
4: 66
900118714_900118717 -5 Left 900118714 1:1039633-1039655 CCTGAGGCAGCTTTGTTGGCCAC 0: 1
1: 0
2: 1
3: 11
4: 160
Right 900118717 1:1039651-1039673 GCCACGTTGAGGTCTGGTGATGG 0: 1
1: 0
2: 1
3: 17
4: 172
900118714_900118721 16 Left 900118714 1:1039633-1039655 CCTGAGGCAGCTTTGTTGGCCAC 0: 1
1: 0
2: 1
3: 11
4: 160
Right 900118721 1:1039672-1039694 GGGACGTGTGTCAGGCGCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 149
900118714_900118720 8 Left 900118714 1:1039633-1039655 CCTGAGGCAGCTTTGTTGGCCAC 0: 1
1: 0
2: 1
3: 11
4: 160
Right 900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900118714 Original CRISPR GTGGCCAACAAAGCTGCCTC AGG (reversed) Intronic
900118714 1:1039633-1039655 GTGGCCAACAAAGCTGCCTCAGG - Intronic
902712650 1:18250960-18250982 CTGGCCAGAAAAGATGCCTCTGG + Intronic
902846703 1:19116459-19116481 GTGGCCATGAAGGCTGCCTAGGG - Intronic
903541076 1:24096674-24096696 CTGCCCAAGACAGCTGCCTCAGG + Intronic
904672341 1:32175294-32175316 GTGGCCTGCCTAGCTGCCTCTGG + Exonic
910787929 1:91021384-91021406 GTGGCCAGAAACGCTGGCTCTGG - Intronic
918774191 1:188608276-188608298 GAGGCCATCAATGTTGCCTCGGG - Intergenic
921029945 1:211327766-211327788 GTGGCAGGCAGAGCTGCCTCAGG + Intronic
921518287 1:216125610-216125632 GTTGCCATTAAAGTTGCCTCTGG + Intronic
922341274 1:224657078-224657100 TTGGCCATCAATGTTGCCTCTGG - Intronic
923134947 1:231109454-231109476 GTGGCCATCAGAGCTGCCACTGG + Intergenic
923495742 1:234522734-234522756 GTGGCCAGGAAATCTGCCTTCGG - Intergenic
924902525 1:248416822-248416844 TTGGCCATCAATGTTGCCTCTGG - Intergenic
1066299437 10:34083872-34083894 GTGGCCAAGAACCCTTCCTCAGG - Intergenic
1067744968 10:48928751-48928773 GCGGTCAGCAAAGCTGCCACAGG - Intronic
1069316113 10:67104979-67105001 GTGGACAACAAAGATGCTCCTGG + Intronic
1071962112 10:90817100-90817122 GTGGCCACTGATGCTGCCTCTGG + Intronic
1072569123 10:96643164-96643186 TTGGATAACAAAGCAGCCTCTGG - Intronic
1078353880 11:10618917-10618939 ATGGCCAACACAGCAGCCGCAGG - Intronic
1084670767 11:70605316-70605338 GTGGCCAGCCAGGCTGTCTCCGG - Intronic
1085774050 11:79349737-79349759 GTGGCCAGGAAAGCTCTCTCTGG + Intronic
1087317894 11:96625667-96625689 GTGGCCAAAACAGCAGCCTTAGG + Intergenic
1088725930 11:112634647-112634669 GAGGCCAGCAAAGAGGCCTCTGG - Intergenic
1089249319 11:117146016-117146038 ATGGACAACAAAGCTTCCCCTGG + Intronic
1095397971 12:41782747-41782769 GTGCCCAACATAGTTGCCTCCGG + Intergenic
1099426488 12:82530218-82530240 GTGGCAAACAAAAATGTCTCTGG + Intergenic
1099693119 12:85986166-85986188 GCAGCCAACAAGGCTGACTCAGG - Intronic
1101051456 12:100868224-100868246 GGACCCAACAATGCTGCCTCAGG - Intronic
1101479409 12:105083182-105083204 GAGGCCAACAAAACAGGCTCAGG + Intronic
1103029782 12:117603631-117603653 TTAGCCATCAATGCTGCCTCTGG + Intronic
1104012733 12:124943429-124943451 GAGGCCAACAGGGCTGCTTCGGG + Intergenic
1105339576 13:19507803-19507825 GTAACCAACAAAGCTGTTTCTGG + Intronic
1105882063 13:24614055-24614077 GTGGCCACCACAGCAGCATCCGG - Intergenic
1107710957 13:43150361-43150383 CTGGTCAGAAAAGCTGCCTCTGG + Intergenic
1108128095 13:47266910-47266932 GTAGCCAGCAAATCTCCCTCAGG + Intergenic
1112408108 13:99138558-99138580 GTGGCCATTAATGTTGCCTCTGG - Intergenic
1113132587 13:107054628-107054650 ATGGCCAACAGAGATGCCTTTGG + Intergenic
1113887256 13:113667439-113667461 GCTGCCGTCAAAGCTGCCTCGGG - Exonic
1114613815 14:24058032-24058054 GTCGGCCACAAAGCTGCCCCTGG + Exonic
1115792821 14:36898743-36898765 GTGGCCACCAGAGCTGCCAGTGG + Intronic
1117369669 14:55065510-55065532 CTGGGCAAAAGAGCTGCCTCAGG - Exonic
1117776488 14:59189208-59189230 GTGTCCACCAAGCCTGCCTCGGG - Intronic
1119187065 14:72650576-72650598 GTGGCCAACACAGCCTCATCTGG + Intronic
1120009470 14:79397037-79397059 GTTTCCAAGACAGCTGCCTCTGG - Intronic
1120745307 14:88146600-88146622 CTGGCTAACACAGCTGCCTATGG + Intergenic
1121273053 14:92650785-92650807 GTGGCCACCAAAGCAGGCTAGGG - Intronic
1123830570 15:24132092-24132114 GTGGCTACCAATACTGCCTCTGG - Intergenic
1127730564 15:61798094-61798116 TTGGCCTCCAGAGCTGCCTCAGG - Intergenic
1128429844 15:67581773-67581795 TTGGCCAAGACAGCTGCCTTTGG - Intronic
1129888416 15:79054937-79054959 ATGGCCAAATAAGCTTCCTCAGG - Intronic
1131258723 15:90877561-90877583 GTGGCCAACAACGGTGTCTGTGG + Exonic
1134241281 16:12508833-12508855 GTCCCCAAGAAAGCTCCCTCAGG - Intronic
1134671634 16:16060070-16060092 CTGGCCAACAAGGATGGCTCAGG - Intronic
1136610597 16:31362875-31362897 CTGGCCCACAGGGCTGCCTCTGG + Intronic
1136618178 16:31411016-31411038 CTGGCCCACAGGGCTGCCTCTGG + Intronic
1137677040 16:50308862-50308884 GTGGCCTTAAAAGCTGCCTCTGG + Intronic
1138634377 16:58325268-58325290 CTGGCCCACCAACCTGCCTCTGG + Intronic
1139325996 16:66152853-66152875 GTGGCCAGCAAGGCTGACCCTGG + Intergenic
1139692682 16:68651100-68651122 GTGGCCAACAGGGCTCCCTCGGG - Intronic
1140891234 16:79287079-79287101 GAGGACAACAAAGCTGATTCTGG - Intergenic
1142172512 16:88630369-88630391 GTGGTGAACTAAGCAGCCTCAGG + Intronic
1144128770 17:12225900-12225922 GTGAACAACACACCTGCCTCAGG - Intergenic
1144377294 17:14657164-14657186 GTGGGTCACAAAGCTGCTTCAGG + Intergenic
1144947556 17:18977680-18977702 GGGTCCAACAAAGGTCCCTCGGG + Exonic
1145005130 17:19333262-19333284 GCAGCCAACAAAGCTGCCTCAGG - Intronic
1147781409 17:42945360-42945382 TTGGCCAACCAAGGTGGCTCAGG + Intergenic
1147927506 17:43954601-43954623 GTGGCCGACTCAGCTGCTTCTGG - Intronic
1148969397 17:51466146-51466168 GTGGCCAACAAAGCTGAGAGAGG - Intergenic
1148989829 17:51656145-51656167 GTGACCAACAAAACTGCCAGGGG + Intronic
1149236342 17:54594753-54594775 GAGGCCACCAATGTTGCCTCAGG + Intergenic
1153972965 18:10243082-10243104 CTGGCCAATTGAGCTGCCTCCGG - Intergenic
1154437528 18:14358112-14358134 GTGGCCCACAGGGCTCCCTCGGG - Intergenic
1155197067 18:23485364-23485386 TTGGCCATCAACACTGCCTCTGG + Intronic
1156536978 18:37873603-37873625 GAGGCCAAGGAAGCTGCTTCAGG - Intergenic
1157073855 18:44442754-44442776 GTGGCCAACAATTCTACTTCTGG + Intergenic
1157107653 18:44789897-44789919 GGGGCCAGCAAAGCAGCCCCGGG - Intronic
1158277665 18:55786136-55786158 GTGTCCAACAATGATGCCTAGGG - Intergenic
1159287463 18:66372955-66372977 GAGGCCAACACTGTTGCCTCAGG - Intergenic
1160957487 19:1700205-1700227 GTGGCCACCAAGGCTGGCCCAGG + Intergenic
1161621685 19:5301077-5301099 CTGGCCAGCAAAGCATCCTCTGG + Intronic
1163296350 19:16415369-16415391 GTGCCCAAAGAGGCTGCCTCAGG + Intronic
1164117640 19:22237625-22237647 GAGGCCATCACAGTTGCCTCAGG + Intergenic
1165047091 19:33113834-33113856 GTGGGCAAGGAAGCTGTCTCTGG - Exonic
1165873779 19:38991486-38991508 TTGGCCAAGAATGCAGCCTCTGG + Intronic
1166951066 19:46428396-46428418 GTGGACACCTGAGCTGCCTCGGG + Intergenic
1167848400 19:52183348-52183370 TTAGGCAACAAATCTGCCTCTGG + Intergenic
925414211 2:3657985-3658007 GTCCCTAACAAAGCTGCCTCCGG - Intergenic
925460395 2:4057964-4057986 GTGGCCATCACTGTTGCCTCAGG - Intergenic
927319117 2:21722051-21722073 GTGGCATTCAAAGCTGCCCCGGG - Intergenic
928584524 2:32745313-32745335 GTGGCCATCATGTCTGCCTCAGG - Intronic
930735766 2:54777072-54777094 GTGGACAGCAAAGCTGCAGCTGG - Intronic
932569498 2:72931185-72931207 GTGCCCTAGGAAGCTGCCTCTGG + Intronic
933221567 2:79695933-79695955 TTAGCCATCAATGCTGCCTCTGG - Intronic
934514560 2:94977986-94978008 GTGGCCACCCACGCTGCCTACGG + Intergenic
934763452 2:96868561-96868583 TTGGGCAACAAAGGGGCCTCGGG - Intronic
934967788 2:98737965-98737987 GTGACACACACAGCTGCCTCTGG + Intergenic
936935452 2:117835160-117835182 GTTCCCAACACAGCTGCCTCTGG - Intergenic
939213493 2:139209405-139209427 GAGGCCATCAATGTTGCCTCAGG - Intergenic
941520169 2:166532285-166532307 GTGGTCAACAAAGCTTTCTCTGG - Intergenic
945276662 2:207994652-207994674 GTGGACACCAAAGCTTTCTCAGG - Intronic
947914808 2:233824160-233824182 GTGGCCAACTAAGCTGTAGCAGG + Intronic
1169647459 20:7828631-7828653 GTGGCCAAACAAGCTCACTCAGG + Intergenic
1173621338 20:44439103-44439125 GTGGCCTAGAAGGCTACCTCTGG - Intergenic
1176799539 21:13411288-13411310 GAGGCCAACAATGCAGACTCAGG + Intergenic
1180959311 22:19755483-19755505 GGCGCCAACACAGCAGCCTCGGG - Intergenic
1184285874 22:43471296-43471318 GTGGCCACCATCGCTGCCTTCGG - Intronic
1185059822 22:48600421-48600443 GTGGCCACAAGGGCTGCCTCGGG - Intronic
949841124 3:8321199-8321221 GTGCGGAACACAGCTGCCTCTGG - Intergenic
949862043 3:8514876-8514898 GTGGCCCAGAAAGTTCCCTCAGG - Intronic
951205884 3:19925626-19925648 GTGGCCAAGCAAGGTGTCTCCGG - Intronic
952571805 3:34726444-34726466 GTGGCCAGGAAGGCAGCCTCTGG + Intergenic
954651761 3:52168958-52168980 GTGGCCATTAATGTTGCCTCTGG + Intergenic
955809063 3:62767250-62767272 GTGGCCAACAGAACTGCTACTGG - Intronic
957634122 3:82759620-82759642 GAGGCCATCACTGCTGCCTCAGG - Intergenic
957754282 3:84466858-84466880 GAGGCCATCACTGCTGCCTCAGG - Intergenic
964516641 3:157517039-157517061 CTGACCAACAAAACTGACTCTGG - Intronic
965428687 3:168560275-168560297 GTGGCCAACAAGGCCTCCTAGGG - Intergenic
966649836 3:182287696-182287718 TTGTCCCAGAAAGCTGCCTCAGG + Intergenic
967413940 3:189196057-189196079 TAGGCCAACAAAGCTTTCTCAGG + Intronic
967545709 3:190724624-190724646 GTGGCCATCAGAGCTCCTTCTGG - Intergenic
968871768 4:3246092-3246114 GTGGCCAACACTGCCGCCGCTGG - Intronic
969483781 4:7460346-7460368 GTGGCCAACGCAGCTTCCACGGG + Intronic
969643139 4:8411188-8411210 GTGGCCCACAGAGCTGCCCTGGG + Intronic
971878740 4:32340364-32340386 GTGGCCACTGATGCTGCCTCTGG + Intergenic
973729761 4:53811738-53811760 GTGACTAAAAAATCTGCCTCAGG + Intronic
973925165 4:55729702-55729724 TTGGCCATCAATACTGCCTCTGG + Intergenic
974766025 4:66347829-66347851 GAGGCTAACAAAGCTGTCTAAGG + Intergenic
976484452 4:85585389-85585411 GTGGCTATCAAGCCTGCCTCTGG + Intronic
976572954 4:86634687-86634709 GTTGCCAACAAAGCTGGGTCTGG + Intronic
980497854 4:133607891-133607913 GAGGCCATCACAGTTGCCTCAGG + Intergenic
983581917 4:169317750-169317772 GAGGCCATCACTGCTGCCTCAGG - Intergenic
985922115 5:2985606-2985628 CTGGCCAACAATGATGCATCCGG + Intergenic
992221492 5:74578188-74578210 GTGCCCAACACAGATGCCTTAGG + Intergenic
997585686 5:135041644-135041666 GTGCCAAAAAATGCTGCCTCTGG + Intronic
998421115 5:141987347-141987369 TTGACCATCAATGCTGCCTCTGG - Intronic
1001137478 5:169114682-169114704 GTGGCCAAGAAAGCAGCTGCAGG - Intronic
1001269522 5:170301011-170301033 GCGGCCATGAAAGCAGCCTCTGG + Intergenic
1001536196 5:172499635-172499657 CTGGCTAAGAAAGCTGGCTCTGG - Intergenic
1001669982 5:173465827-173465849 GTGACCACAAAATCTGCCTCAGG + Intergenic
1001929477 5:175662562-175662584 GTGGCCAATAGAGCAACCTCAGG - Intronic
1004880205 6:19999946-19999968 GTGGCCTCCAAAGTTGCCCCAGG - Intergenic
1013010058 6:106112233-106112255 GTGGCCATCAAATCTACTTCTGG + Intergenic
1013512714 6:110859062-110859084 GTGGCCGACAGGGCTCCCTCGGG + Intronic
1016845119 6:148561923-148561945 GGGGCCGACACAGCTGCCACTGG - Intergenic
1017873613 6:158505716-158505738 CTGTCCAACACCGCTGCCTCAGG - Intronic
1022729240 7:33007167-33007189 GTGGCCAACACTGCTGTCACTGG - Intergenic
1025044415 7:55680813-55680835 GTGGCCAACACTGCTGTCACTGG + Intergenic
1029223630 7:99009229-99009251 GAGGCCAAAACAGCTGCCCCTGG - Intronic
1033625199 7:143104350-143104372 TTGGCCATCAATGCTGCTTCTGG + Intergenic
1034029667 7:147746610-147746632 GTGGCCAAGAAAGCTTCCCCAGG - Intronic
1035196768 7:157228387-157228409 GTGGGTAACAAAGTTCCCTCGGG + Intronic
1036828221 8:11996400-11996422 ATTGCCAACACGGCTGCCTCAGG - Intergenic
1037809923 8:22081148-22081170 GGGGCGAACCAAGCTGCCACCGG + Exonic
1037908199 8:22727810-22727832 GTGGCCAAAGAAACTGCCCCAGG - Intronic
1042933455 8:74035421-74035443 GTGGCCATCGATGTTGCCTCTGG + Intergenic
1043572227 8:81618006-81618028 GTGGCCAACTCAGCTGCATATGG - Intergenic
1043924470 8:86021368-86021390 GTGGCCCACAACACAGCCTCAGG + Intronic
1048842687 8:138579254-138579276 GTGCCCAGCATACCTGCCTCAGG - Intergenic
1049042410 8:140122711-140122733 GAGAGGAACAAAGCTGCCTCAGG + Intronic
1049658223 8:143808265-143808287 CTGGCCAGCAGAGCTGCCTCTGG + Intronic
1050365460 9:4869616-4869638 GAGGCCACAAAAGATGCCTCAGG + Intronic
1051314455 9:15813068-15813090 GTGGCCAAAAACGCAGCCTGTGG + Intronic
1051377470 9:16417923-16417945 GTGGCCAACAAATTGGCCTGTGG + Exonic
1052889886 9:33688968-33688990 GTGGCTAACAAAGAAGGCTCTGG - Intergenic
1058119000 9:101117951-101117973 GTGTCCAACAAAGCAGCCCTTGG - Intronic
1059015492 9:110511032-110511054 ATGGCCAACAAAGGGGCCTAAGG + Intronic
1061441658 9:130608451-130608473 GTGGCCAACATACCTCCCTCAGG + Intronic
1061675333 9:132212351-132212373 GTGTGCAAGGAAGCTGCCTCTGG + Intronic
1061961540 9:133991556-133991578 GGGGCCAACCCAGCTCCCTCCGG + Intronic
1062198798 9:135289753-135289775 CTGGCCAACACAGAGGCCTCAGG - Intergenic
1195605645 X:106802991-106803013 GTGGCCACCCTACCTGCCTCTGG + Intronic
1196872973 X:120130202-120130224 TTAGCCATCAATGCTGCCTCTGG - Intergenic
1199200214 X:145078499-145078521 GTTGGCAACAAAGCTGCTTAAGG - Intergenic