ID: 900118720

View in Genome Browser
Species Human (GRCh38)
Location 1:1039664-1039686
Sequence CTGGTGATGGGACGTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900118714_900118720 8 Left 900118714 1:1039633-1039655 CCTGAGGCAGCTTTGTTGGCCAC 0: 1
1: 0
2: 1
3: 11
4: 160
Right 900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900118720 Original CRISPR CTGGTGATGGGACGTGTGTC AGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900135284 1:1114602-1114624 CTGGGGGCGGGATGTGTGTCAGG + Intronic
900737271 1:4306868-4306890 CTGGTGGTGGGGCATTTGTCTGG + Intergenic
902661735 1:17909063-17909085 CTGGTCATGTGACCTGGGTCTGG - Intergenic
902884596 1:19395703-19395725 CAGGTGATGGGTTGTGTGCCTGG - Intronic
903682750 1:25108057-25108079 CAGGTGATGGGACTTGTCTTTGG + Intergenic
906558611 1:46736050-46736072 ATGGTTTTGGGATGTGTGTCTGG + Intergenic
908512331 1:64859425-64859447 CTGGTGATGGGCAATGTGTGAGG - Intronic
915657190 1:157370923-157370945 CTGGTGGAGGCACGTGTGTTGGG - Intergenic
917076183 1:171207467-171207489 CTGGAAAAGGGAAGTGTGTCTGG - Intronic
919801502 1:201357314-201357336 GTCATGATGGGCCGTGTGTCTGG - Intergenic
920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG + Intronic
1065493434 10:26305596-26305618 CTGGTGAGGCTACGTGTTTCAGG + Intergenic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1072618417 10:97064488-97064510 CGGGTGATGGGACGCGTCCCAGG + Intronic
1072637629 10:97187786-97187808 CAGGTGCTGGGGTGTGTGTCTGG - Intronic
1074105060 10:110383155-110383177 CTGGAGATGGGGAATGTGTCAGG + Intergenic
1074410671 10:113225769-113225791 CTGGAGATGGGAGATGTGTTAGG + Intergenic
1075060931 10:119256281-119256303 CTGGTGCTGTGAGGTGTGTGGGG - Intronic
1076815632 10:132913441-132913463 CTGTTGATGGGACGGGAGGCGGG - Intronic
1077020373 11:414522-414544 GTGGTAATGGGAGGTGTGTGTGG - Intronic
1089517879 11:119045237-119045259 CCGGTGATGGGAAGGGTATCAGG - Exonic
1091002692 11:131923837-131923859 CTGGGGATGGGAGGAGGGTCGGG - Intronic
1091317344 11:134623917-134623939 CTGGGGCTGGGACTTGTGTTGGG - Intergenic
1091632478 12:2172346-2172368 CTGGTGATGTGACAAGAGTCTGG - Intronic
1092172461 12:6382711-6382733 CAGGTGATGGGAAGTGTGCATGG - Intronic
1097227047 12:57483655-57483677 GTGGAGAAGGGACGTGTTTCAGG - Intronic
1103704110 12:122862194-122862216 CGGCTGATGGGACGAGGGTCAGG + Exonic
1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG + Intergenic
1104114256 12:125734277-125734299 CTGGTGGTGGGAGGGGCGTCAGG + Intergenic
1110721329 13:78765479-78765501 TTGGTGATGGGACAGGTTTCAGG - Intergenic
1111655396 13:91145634-91145656 TTGGTGAGGGGAGGTGTGTGTGG + Intergenic
1118736822 14:68706928-68706950 CTGGTGATGGCACGTAAGACTGG - Intronic
1121732821 14:96198112-96198134 CTGGTGCTGGGACGTCCGCCTGG - Intergenic
1122363449 14:101180929-101180951 CCTGTCATGGGAGGTGTGTCAGG - Intergenic
1202849363 14_GL000225v1_random:7480-7502 CAGGTGATGGGACTTTTCTCTGG - Intergenic
1128560918 15:68667190-68667212 CTGGTGAGGGCAGGTGAGTCAGG - Intronic
1137496161 16:48970986-48971008 CTGGGGATGGGATGTGGTTCAGG + Intergenic
1138646110 16:58426228-58426250 TTTGTGGTGGGACGTGTGGCAGG - Intergenic
1139672007 16:68498516-68498538 CTGTTGATGGCAAGAGTGTCTGG + Intergenic
1142480766 17:216871-216893 GGGGTGGTGGTACGTGTGTCAGG + Intronic
1144062806 17:11598757-11598779 CTGGAGGTGGGACCTGAGTCGGG + Exonic
1145932212 17:28693944-28693966 CTGCTGGTGGGAAGTGTTTCAGG + Intronic
1147325546 17:39667913-39667935 TGGGTGCTGGGACGGGTGTCCGG + Intergenic
1147664799 17:42139792-42139814 CTGTGGCTGGGACGTGTGTGTGG - Intronic
1150886761 17:69095677-69095699 CTGGTGATTGAATGTCTGTCTGG - Intronic
1151316079 17:73323516-73323538 CTCTTGATGGGAAGTGTGTCTGG + Intergenic
1151775804 17:76200961-76200983 CTGGGGTTGGGATGTGTGCCAGG - Intronic
1152183346 17:78839315-78839337 CTGGGGATGGGAAGTGACTCAGG - Intronic
1152737560 17:82004866-82004888 CTGGTGAAGGCACTGGTGTCCGG + Intronic
1155260473 18:24037515-24037537 CTTGTGATAGGACATTTGTCTGG + Intronic
1158314165 18:56192156-56192178 CTGCTGATGGCATGTGTGGCTGG - Intergenic
1162065621 19:8123698-8123720 CTGGAGATGGGAAGTGTGTTTGG - Intronic
1163189602 19:15666898-15666920 CTGCTGATGGGAGGTGCTTCTGG + Intergenic
925142411 2:1559252-1559274 CTGGTGAGGGGCCCTGTGTGGGG - Intergenic
925985823 2:9213874-9213896 CTGGTTATAGGACTTGTGTTGGG + Intronic
927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG + Intergenic
932620915 2:73264564-73264586 CTGGTGTGGGGATGTGTGTGGGG + Intronic
936278874 2:111121453-111121475 CTGGTGAAGGGTCGTAGGTCCGG + Intronic
945958150 2:216105488-216105510 GTGGTGATGGTATGTGTGTTGGG - Intergenic
946584171 2:221165461-221165483 CTGGTCTTGGGATCTGTGTCTGG + Intergenic
948802614 2:240439735-240439757 CTGGTGAGGGGCTGTGTGCCAGG - Intronic
1170113812 20:12835567-12835589 CTGGAGATGGGAAGTCTGTATGG - Intergenic
1171414417 20:24967975-24967997 CTGTTGCTGGGCTGTGTGTCTGG - Intronic
1175276607 20:57775031-57775053 CTGGTGATGGGTCCTGAGACGGG + Intergenic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG + Intronic
949663047 3:6303880-6303902 TTGGTGCTGGGGCTTGTGTCTGG + Intergenic
950838995 3:15948751-15948773 CTGGTTATGAAACATGTGTCTGG - Intergenic
953446868 3:42975912-42975934 CTGGTGCAGGGAGGTATGTCAGG + Intronic
954708776 3:52494875-52494897 CTAGTGAGGGGATGTGGGTCTGG + Intergenic
959636792 3:108583602-108583624 GTGGTGATGGGAGGTGTGAGGGG + Intronic
967109328 3:186279730-186279752 CTGGTCATGGCACGTCTGTTGGG + Intronic
967836069 3:193963944-193963966 CTGGTGACACGACGTGTGTGTGG - Intergenic
969377459 4:6772183-6772205 CTGGTGCTGGGGCCTGTGACGGG - Intergenic
971721920 4:30255917-30255939 CTGGTGCTAGTACTTGTGTCTGG - Intergenic
973649885 4:52988144-52988166 TTGATGACGGGAGGTGTGTCTGG - Intronic
975696786 4:77021606-77021628 CAGGTGGTGTGAGGTGTGTCTGG + Intronic
985285527 4:188332966-188332988 TTGGGGATTGGACGTGGGTCTGG + Intergenic
985492972 5:190005-190027 CTGGAAAGGGGCCGTGTGTCTGG + Intergenic
985663378 5:1168765-1168787 CCTGTGATGGGGCGTGTGTTGGG - Intergenic
985938441 5:3114458-3114480 CTGGTGCTGCCACGTGTGTGGGG + Intergenic
986266844 5:6198015-6198037 CTGGTGAGCAGAAGTGTGTCTGG - Intergenic
991582604 5:68172571-68172593 CTGGTGGTGGGGCCTTTGTCTGG + Intergenic
993179316 5:84530589-84530611 CTCATGATGGGACAAGTGTCAGG + Intergenic
998564715 5:143206867-143206889 CTGGTGATAGCACGTGGGTGTGG + Intronic
999709861 5:154308505-154308527 CTGGTGATGCCACGTGGGGCAGG - Intronic
1005253443 6:23973104-23973126 CTGGTGTTGTGTCCTGTGTCTGG + Intergenic
1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG + Intergenic
1007737737 6:43992241-43992263 GTGGAGATGGGATGTGTGGCAGG + Intergenic
1015384909 6:132610837-132610859 TTGGTGATGGGAGGTGTGCAGGG + Intergenic
1016702333 6:147067614-147067636 CTGGTGATGGGGAGTGGGTCAGG + Intergenic
1021891269 7:25188403-25188425 CTGGTGATGGGAATTGGATCTGG - Intergenic
1022043141 7:26599794-26599816 CTGGGGAGGGGAGGTGTGTGAGG + Intergenic
1023630276 7:42156814-42156836 CTGGTGATGGGAGGAGGGTGTGG - Intronic
1024524409 7:50336327-50336349 CTGGTGAAGGGGCGTGCGTGGGG + Intronic
1029736853 7:102469841-102469863 CTGCTGCTGGGACGTGCGGCTGG + Exonic
1046637251 8:116683603-116683625 TTGGTGATGGTACGTGTGCATGG + Intronic
1047260440 8:123253885-123253907 CTGGTGATGGCCACTGTGTCCGG + Exonic
1049385902 8:142342865-142342887 CAGGTGCTGGGACAGGTGTCCGG - Intronic
1051822273 9:21181735-21181757 CTGGTGATGTGACGGGTGGGTGG - Intergenic
1053150599 9:35740506-35740528 CTGGTGATGGGGGGTCTGACTGG - Exonic
1056505565 9:87255060-87255082 ATGGTGAAGGGAAGTGTCTCCGG - Intergenic
1057547976 9:96032189-96032211 CTGATGAAGGGAGGTGTGTGGGG - Intergenic
1187293387 X:17976505-17976527 CTGGAGATGGGAGGGGTGCCAGG - Intergenic
1188051018 X:25486172-25486194 TTTGTGATGGGACGCGTGTCAGG - Intergenic
1190641953 X:52488444-52488466 CTGGCCATGGGAAGTGAGTCTGG - Intergenic
1190645719 X:52524422-52524444 CTGGCCATGGGAAGTGAGTCTGG + Intergenic
1198157186 X:133972780-133972802 CTGGTGATGGTATCTCTGTCTGG - Intronic
1202624458 Y:56843126-56843148 CTGGTGATGTAACATTTGTCTGG + Intergenic