ID: 900119924

View in Genome Browser
Species Human (GRCh38)
Location 1:1044236-1044258
Sequence CCGGGCTGCCTGGGACACTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 276}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900119924_900119937 12 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119937 1:1044271-1044293 CCCTGGCTCTCGGCGGGCGGCGG 0: 1
1: 1
2: 2
3: 24
4: 423
900119924_900119933 6 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119933 1:1044265-1044287 CTGTACCCCTGGCTCTCGGCGGG 0: 1
1: 0
2: 1
3: 10
4: 148
900119924_900119944 26 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG 0: 1
1: 0
2: 34
3: 259
4: 1834
900119924_900119941 18 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119941 1:1044277-1044299 CTCTCGGCGGGCGGCGGGGACGG 0: 1
1: 0
2: 5
3: 39
4: 264
900119924_900119943 20 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119943 1:1044279-1044301 CTCGGCGGGCGGCGGGGACGGGG 0: 1
1: 0
2: 4
3: 70
4: 468
900119924_900119931 2 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119931 1:1044261-1044283 AGCTCTGTACCCCTGGCTCTCGG 0: 1
1: 0
2: 2
3: 35
4: 270
900119924_900119929 -5 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119929 1:1044254-1044276 CCCGGTGAGCTCTGTACCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 103
900119924_900119932 5 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119932 1:1044264-1044286 TCTGTACCCCTGGCTCTCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 105
900119924_900119939 13 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119939 1:1044272-1044294 CCTGGCTCTCGGCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 42
4: 226
900119924_900119940 14 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119940 1:1044273-1044295 CTGGCTCTCGGCGGGCGGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 207
900119924_900119934 9 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119934 1:1044268-1044290 TACCCCTGGCTCTCGGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 81
900119924_900119942 19 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119942 1:1044278-1044300 TCTCGGCGGGCGGCGGGGACGGG 0: 1
1: 0
2: 2
3: 18
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900119924 Original CRISPR CCGGGCTGCCTGGGACACTC TGG (reversed) Exonic