ID: 900119926

View in Genome Browser
Species Human (GRCh38)
Location 1:1044245-1044267
Sequence CAGAGCTCACCGGGCTGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 187}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900119926_900119943 11 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119943 1:1044279-1044301 CTCGGCGGGCGGCGGGGACGGGG 0: 1
1: 0
2: 4
3: 70
4: 468
900119926_900119934 0 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119934 1:1044268-1044290 TACCCCTGGCTCTCGGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 81
900119926_900119931 -7 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119931 1:1044261-1044283 AGCTCTGTACCCCTGGCTCTCGG 0: 1
1: 0
2: 2
3: 35
4: 270
900119926_900119932 -4 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119932 1:1044264-1044286 TCTGTACCCCTGGCTCTCGGCGG 0: 1
1: 0
2: 1
3: 5
4: 105
900119926_900119937 3 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119937 1:1044271-1044293 CCCTGGCTCTCGGCGGGCGGCGG 0: 1
1: 1
2: 2
3: 24
4: 423
900119926_900119942 10 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119942 1:1044278-1044300 TCTCGGCGGGCGGCGGGGACGGG 0: 1
1: 0
2: 2
3: 18
4: 240
900119926_900119944 17 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG 0: 1
1: 0
2: 34
3: 259
4: 1834
900119926_900119941 9 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119941 1:1044277-1044299 CTCTCGGCGGGCGGCGGGGACGG 0: 1
1: 0
2: 5
3: 39
4: 264
900119926_900119940 5 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119940 1:1044273-1044295 CTGGCTCTCGGCGGGCGGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 207
900119926_900119939 4 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119939 1:1044272-1044294 CCTGGCTCTCGGCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 42
4: 226
900119926_900119933 -3 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119933 1:1044265-1044287 CTGTACCCCTGGCTCTCGGCGGG 0: 1
1: 0
2: 1
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900119926 Original CRISPR CAGAGCTCACCGGGCTGCCT GGG (reversed) Exonic