ID: 900119929

View in Genome Browser
Species Human (GRCh38)
Location 1:1044254-1044276
Sequence CCCGGTGAGCTCTGTACCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900119924_900119929 -5 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119929 1:1044254-1044276 CCCGGTGAGCTCTGTACCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 103
900119922_900119929 18 Left 900119922 1:1044213-1044235 CCGTGTGTCTGTGACTTCAGCTG 0: 1
1: 0
2: 1
3: 42
4: 454
Right 900119929 1:1044254-1044276 CCCGGTGAGCTCTGTACCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900119929 Original CRISPR CCCGGTGAGCTCTGTACCCC TGG Exonic