ID: 900119930

View in Genome Browser
Species Human (GRCh38)
Location 1:1044255-1044277
Sequence GCCAGGGGTACAGAGCTCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 166}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900119930_900119939 -6 Left 900119930 1:1044255-1044277 CCGGTGAGCTCTGTACCCCTGGC 0: 1
1: 0
2: 3
3: 12
4: 166
Right 900119939 1:1044272-1044294 CCTGGCTCTCGGCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 42
4: 226
900119930_900119941 -1 Left 900119930 1:1044255-1044277 CCGGTGAGCTCTGTACCCCTGGC 0: 1
1: 0
2: 3
3: 12
4: 166
Right 900119941 1:1044277-1044299 CTCTCGGCGGGCGGCGGGGACGG 0: 1
1: 0
2: 5
3: 39
4: 264
900119930_900119944 7 Left 900119930 1:1044255-1044277 CCGGTGAGCTCTGTACCCCTGGC 0: 1
1: 0
2: 3
3: 12
4: 166
Right 900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG 0: 1
1: 0
2: 34
3: 259
4: 1834
900119930_900119937 -7 Left 900119930 1:1044255-1044277 CCGGTGAGCTCTGTACCCCTGGC 0: 1
1: 0
2: 3
3: 12
4: 166
Right 900119937 1:1044271-1044293 CCCTGGCTCTCGGCGGGCGGCGG 0: 1
1: 1
2: 2
3: 24
4: 423
900119930_900119942 0 Left 900119930 1:1044255-1044277 CCGGTGAGCTCTGTACCCCTGGC 0: 1
1: 0
2: 3
3: 12
4: 166
Right 900119942 1:1044278-1044300 TCTCGGCGGGCGGCGGGGACGGG 0: 1
1: 0
2: 2
3: 18
4: 240
900119930_900119940 -5 Left 900119930 1:1044255-1044277 CCGGTGAGCTCTGTACCCCTGGC 0: 1
1: 0
2: 3
3: 12
4: 166
Right 900119940 1:1044273-1044295 CTGGCTCTCGGCGGGCGGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 207
900119930_900119943 1 Left 900119930 1:1044255-1044277 CCGGTGAGCTCTGTACCCCTGGC 0: 1
1: 0
2: 3
3: 12
4: 166
Right 900119943 1:1044279-1044301 CTCGGCGGGCGGCGGGGACGGGG 0: 1
1: 0
2: 4
3: 70
4: 468
900119930_900119934 -10 Left 900119930 1:1044255-1044277 CCGGTGAGCTCTGTACCCCTGGC 0: 1
1: 0
2: 3
3: 12
4: 166
Right 900119934 1:1044268-1044290 TACCCCTGGCTCTCGGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900119930 Original CRISPR GCCAGGGGTACAGAGCTCAC CGG (reversed) Exonic