ID: 900119931

View in Genome Browser
Species Human (GRCh38)
Location 1:1044261-1044283
Sequence AGCTCTGTACCCCTGGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900119924_900119931 2 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119931 1:1044261-1044283 AGCTCTGTACCCCTGGCTCTCGG 0: 1
1: 0
2: 2
3: 35
4: 270
900119926_900119931 -7 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119931 1:1044261-1044283 AGCTCTGTACCCCTGGCTCTCGG 0: 1
1: 0
2: 2
3: 35
4: 270
900119922_900119931 25 Left 900119922 1:1044213-1044235 CCGTGTGTCTGTGACTTCAGCTG 0: 1
1: 0
2: 1
3: 42
4: 454
Right 900119931 1:1044261-1044283 AGCTCTGTACCCCTGGCTCTCGG 0: 1
1: 0
2: 2
3: 35
4: 270
900119927_900119931 -8 Left 900119927 1:1044246-1044268 CCAGGCAGCCCGGTGAGCTCTGT 0: 1
1: 0
2: 0
3: 14
4: 168
Right 900119931 1:1044261-1044283 AGCTCTGTACCCCTGGCTCTCGG 0: 1
1: 0
2: 2
3: 35
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900119931 Original CRISPR AGCTCTGTACCCCTGGCTCT CGG Intronic