ID: 900119939

View in Genome Browser
Species Human (GRCh38)
Location 1:1044272-1044294
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900119927_900119939 3 Left 900119927 1:1044246-1044268 CCAGGCAGCCCGGTGAGCTCTGT 0: 1
1: 0
2: 0
3: 14
4: 168
Right 900119939 1:1044272-1044294 CCTGGCTCTCGGCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 42
4: 226
900119930_900119939 -6 Left 900119930 1:1044255-1044277 CCGGTGAGCTCTGTACCCCTGGC 0: 1
1: 0
2: 3
3: 12
4: 166
Right 900119939 1:1044272-1044294 CCTGGCTCTCGGCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 42
4: 226
900119924_900119939 13 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119939 1:1044272-1044294 CCTGGCTCTCGGCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 42
4: 226
900119928_900119939 -5 Left 900119928 1:1044254-1044276 CCCGGTGAGCTCTGTACCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 207
Right 900119939 1:1044272-1044294 CCTGGCTCTCGGCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 42
4: 226
900119926_900119939 4 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119939 1:1044272-1044294 CCTGGCTCTCGGCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 42
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type