ID: 900119944

View in Genome Browser
Species Human (GRCh38)
Location 1:1044285-1044307
Sequence GGGCGGCGGGGACGGGGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2128
Summary {0: 1, 1: 0, 2: 34, 3: 259, 4: 1834}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900119928_900119944 8 Left 900119928 1:1044254-1044276 CCCGGTGAGCTCTGTACCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 207
Right 900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG 0: 1
1: 0
2: 34
3: 259
4: 1834
900119924_900119944 26 Left 900119924 1:1044236-1044258 CCAGAGTGTCCCAGGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG 0: 1
1: 0
2: 34
3: 259
4: 1834
900119930_900119944 7 Left 900119930 1:1044255-1044277 CCGGTGAGCTCTGTACCCCTGGC 0: 1
1: 0
2: 3
3: 12
4: 166
Right 900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG 0: 1
1: 0
2: 34
3: 259
4: 1834
900119935_900119944 -8 Left 900119935 1:1044270-1044292 CCCCTGGCTCTCGGCGGGCGGCG 0: 1
1: 0
2: 0
3: 15
4: 111
Right 900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG 0: 1
1: 0
2: 34
3: 259
4: 1834
900119926_900119944 17 Left 900119926 1:1044245-1044267 CCCAGGCAGCCCGGTGAGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 187
Right 900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG 0: 1
1: 0
2: 34
3: 259
4: 1834
900119927_900119944 16 Left 900119927 1:1044246-1044268 CCAGGCAGCCCGGTGAGCTCTGT 0: 1
1: 0
2: 0
3: 14
4: 168
Right 900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG 0: 1
1: 0
2: 34
3: 259
4: 1834
900119938_900119944 -10 Left 900119938 1:1044272-1044294 CCTGGCTCTCGGCGGGCGGCGGG 0: 1
1: 0
2: 2
3: 32
4: 268
Right 900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG 0: 1
1: 0
2: 34
3: 259
4: 1834
900119936_900119944 -9 Left 900119936 1:1044271-1044293 CCCTGGCTCTCGGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 14
4: 130
Right 900119944 1:1044285-1044307 GGGCGGCGGGGACGGGGCTGCGG 0: 1
1: 0
2: 34
3: 259
4: 1834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900119944 Original CRISPR GGGCGGCGGGGACGGGGCTG CGG Intronic