ID: 900120170

View in Genome Browser
Species Human (GRCh38)
Location 1:1045469-1045491
Sequence CCTCGAAAGTTCCAGAAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900120170_900120174 1 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120174 1:1045493-1045515 ATCGTCACCGATGGCCGGAGTGG 0: 1
1: 0
2: 0
3: 0
4: 17
900120170_900120178 22 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120178 1:1045514-1045536 GGCTGTACACGTGAGTGACAGGG 0: 1
1: 0
2: 0
3: 10
4: 98
900120170_900120172 -8 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120172 1:1045484-1045506 TTTCGAGGCATCGTCACCGATGG 0: 1
1: 0
2: 0
3: 0
4: 12
900120170_900120177 21 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120177 1:1045513-1045535 TGGCTGTACACGTGAGTGACAGG 0: 1
1: 0
2: 0
3: 5
4: 86
900120170_900120173 -4 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120173 1:1045488-1045510 GAGGCATCGTCACCGATGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 34
900120170_900120179 28 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120179 1:1045520-1045542 ACACGTGAGTGACAGGGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900120170 Original CRISPR CCTCGAAAGTTCCAGAAGCC AGG (reversed) Exonic