ID: 900120170

View in Genome Browser
Species Human (GRCh38)
Location 1:1045469-1045491
Sequence CCTCGAAAGTTCCAGAAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900120170_900120174 1 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120174 1:1045493-1045515 ATCGTCACCGATGGCCGGAGTGG 0: 1
1: 0
2: 0
3: 0
4: 17
900120170_900120172 -8 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120172 1:1045484-1045506 TTTCGAGGCATCGTCACCGATGG 0: 1
1: 0
2: 0
3: 0
4: 12
900120170_900120177 21 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120177 1:1045513-1045535 TGGCTGTACACGTGAGTGACAGG 0: 1
1: 0
2: 0
3: 5
4: 86
900120170_900120178 22 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120178 1:1045514-1045536 GGCTGTACACGTGAGTGACAGGG 0: 1
1: 0
2: 0
3: 10
4: 98
900120170_900120173 -4 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120173 1:1045488-1045510 GAGGCATCGTCACCGATGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 34
900120170_900120179 28 Left 900120170 1:1045469-1045491 CCTGGCTTCTGGAACTTTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 900120179 1:1045520-1045542 ACACGTGAGTGACAGGGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900120170 Original CRISPR CCTCGAAAGTTCCAGAAGCC AGG (reversed) Exonic
900120170 1:1045469-1045491 CCTCGAAAGTTCCAGAAGCCAGG - Exonic
900977966 1:6028886-6028908 GCTCAAAGGTTCCAGAAGGCTGG - Intronic
901032562 1:6316189-6316211 ACTCGGAAGTGGCAGAAGCCTGG + Intronic
901790530 1:11651379-11651401 CCAGGAAAGTGCCAGATGCCAGG - Intronic
903102220 1:21040517-21040539 AGTCAAAAGTTCCAGAGGCCGGG + Intronic
904412029 1:30330355-30330377 CTTCCAAAGTTCCAGAACTCGGG + Intergenic
906178946 1:43801451-43801473 TCTTGAAGGTTCCTGAAGCCAGG - Intronic
909831595 1:80198263-80198285 CCAAGAAATTTCCAGAAGCTGGG - Intergenic
918441932 1:184576418-184576440 CCTCAAAAGCCACAGAAGCCGGG - Intronic
918535677 1:185572007-185572029 CTTTGGAAGTTCTAGAAGCCTGG - Intergenic
920654050 1:207861918-207861940 CCTAGAATGTTCAAGAAGCCAGG - Intergenic
920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG + Intronic
1063766730 10:9150361-9150383 CCTGGAAAGTTTTAGAAGCAGGG - Intergenic
1065744897 10:28831612-28831634 CCACAAAAGTTCCAGAAGGGAGG - Intergenic
1067142856 10:43670810-43670832 CCTGGAAATGTCCAGAAGCCTGG + Intergenic
1068046498 10:51892833-51892855 CCTCCCAAGTTTCAGAAGACTGG + Intronic
1069580150 10:69560174-69560196 CCTCCAAGGAGCCAGAAGCCTGG - Intergenic
1072464204 10:95648083-95648105 AGTCAGAAGTTCCAGAAGCCTGG + Intronic
1073698111 10:105893594-105893616 CCTGGAAAGGGCCTGAAGCCAGG + Intergenic
1075116994 10:119635130-119635152 ACTAGACACTTCCAGAAGCCAGG + Intergenic
1075404996 10:122188890-122188912 CCTGGAAAATTCTAGCAGCCTGG + Intronic
1076199378 10:128546449-128546471 TTTCACAAGTTCCAGAAGCCCGG + Intergenic
1076551182 10:131279012-131279034 CCCCCAAAGCTCCAGAAGCCCGG + Intronic
1076562113 10:131373774-131373796 CCCCTAAAGATACAGAAGCCTGG + Intergenic
1077165336 11:1132378-1132400 ACTGGAGAGTTCCAGAGGCCTGG + Intergenic
1077624792 11:3761329-3761351 ACTAGAAAGTACTAGAAGCCGGG + Intronic
1078146132 11:8722894-8722916 GCTCCAAAGATCCAGAAGCCAGG + Intronic
1079364027 11:19793568-19793590 CCTGGACTGTTCCAGTAGCCTGG + Intronic
1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG + Intronic
1083267581 11:61553945-61553967 CCTCAGGGGTTCCAGAAGCCAGG - Intronic
1083570173 11:63756371-63756393 CCTACAAAGGTCCAGAAGGCAGG - Intronic
1083871534 11:65491144-65491166 GCTAGAAAATTCCAGAAGCCAGG - Intergenic
1084061937 11:66681424-66681446 ACTCGAAAATTCAAGAGGCCAGG - Intergenic
1085525412 11:77160895-77160917 CCACGAAGGGTCCAGGAGCCTGG + Intronic
1087847201 11:102986970-102986992 CCAAGAAACTACCAGAAGCCAGG - Intergenic
1088700733 11:112408942-112408964 CAGAGAAATTTCCAGAAGCCTGG + Intergenic
1093082182 12:14825271-14825293 CCTCAGTATTTCCAGAAGCCAGG - Intronic
1097226390 12:57479009-57479031 CCCCAAAATTCCCAGAAGCCAGG + Intronic
1102909212 12:116699774-116699796 CCTCGAACTATCCAGAAGGCAGG - Intergenic
1103709017 12:122897063-122897085 CCTCTTAAGATCCAGGAGCCTGG + Intergenic
1104035143 12:125092647-125092669 ACAGGAAAGTTCCAGAAGGCAGG - Intronic
1106856477 13:33859012-33859034 CATCCAAAGTCCCAGAAGTCAGG - Intronic
1106861274 13:33911545-33911567 GCTGGAAAGTTCAAGAAGCATGG + Intronic
1107298952 13:38945801-38945823 CCTAGAATGTTCCAGAGGCCAGG - Intergenic
1113372606 13:109736865-109736887 CCTCTCAAATCCCAGAAGCCAGG - Intergenic
1113836754 13:113333088-113333110 CCTCGAAATTTCCTGCAGACTGG - Intronic
1117334957 14:54749193-54749215 ACTTGAAAGTTCCAGGTGCCAGG + Intronic
1119000366 14:70876260-70876282 CCTAGGAAGTTCCAGAAACCAGG + Intergenic
1124391495 15:29262769-29262791 GGTCAAAAGTTCCAGAGGCCTGG + Intronic
1126450248 15:48800331-48800353 CCCTGAAACTTACAGAAGCCAGG - Intronic
1130196197 15:81782383-81782405 CCCAGAAAGTTCCAGAAAGCTGG + Intergenic
1130989748 15:88869289-88869311 CCCAGAAACTTCCAGAAGGCAGG + Intronic
1132581435 16:686468-686490 CCTGGAGAGCTCCAGAAGCAAGG + Intronic
1133008900 16:2899385-2899407 CCTCAAAGGACCCAGAAGCCTGG - Intergenic
1134395337 16:13857614-13857636 CCTTGAAAGTCACAGAAACCAGG - Intergenic
1138749377 16:59400499-59400521 GCTCCAAAGATCCAGATGCCAGG + Intergenic
1141745679 16:85924601-85924623 CCTCGTAATGTCCAGAAGGCTGG + Intergenic
1142023920 16:87802138-87802160 CCTGGAAAGGTCCTGGAGCCCGG - Intergenic
1143216052 17:5225826-5225848 GCTCTCAAGTTCCAGAGGCCCGG + Intronic
1145826263 17:27879430-27879452 CCTCTCAACTTCCAGAGGCCAGG + Exonic
1152269043 17:79313178-79313200 CCTGGAAGGTGCCAGAAGCAAGG - Intronic
1157271596 18:46280433-46280455 AGTAGCAAGTTCCAGAAGCCAGG - Intergenic
1158663679 18:59412979-59413001 CCTGCAAACCTCCAGAAGCCAGG - Intergenic
1161037567 19:2093951-2093973 CCTGAGAACTTCCAGAAGCCGGG - Intronic
1162931698 19:13960835-13960857 CCCAGAAGGTTCCAGAAGGCAGG - Intronic
1163020702 19:14479627-14479649 CCCAGAAACTTGCAGAAGCCTGG - Intronic
1163627086 19:18396462-18396484 CCCCGATAGTTGCAGAGGCCAGG + Exonic
1166669701 19:44702468-44702490 CCTGGAAAGTACCAGAAAGCTGG + Intronic
1167008042 19:46788067-46788089 CCTCCAAAGTTCCAGTCTCCAGG - Exonic
1167869616 19:52357076-52357098 GGTCGAAAGTTCCAGAGGCCTGG - Intronic
1168096752 19:54120196-54120218 CCTGCAGAGTTCCAGATGCCAGG + Intronic
927077887 2:19598191-19598213 CCTCTAAAGTTTCATCAGCCCGG - Intergenic
927509596 2:23636088-23636110 CCTAGAAGCTTCCAGAACCCGGG + Intronic
931671110 2:64648699-64648721 CTTCTAAAGCTCCAGAAGACAGG - Intronic
932813332 2:74842651-74842673 GATGGAAAGTTCCTGAAGCCAGG + Intronic
933140025 2:78780822-78780844 ACTAGAAAGTTTCAGCAGCCTGG - Intergenic
935121550 2:100187418-100187440 CTTGGAATGTTCCAGAGGCCAGG + Intergenic
937311144 2:120904164-120904186 CCTAGAATGTTCCAGAACTCAGG - Intronic
937504639 2:122523195-122523217 CATAGAAAGTTCCACAAGCTAGG - Intergenic
940013565 2:149080199-149080221 CATAGGAAGTACCAGAAGCCAGG - Intronic
940324877 2:152414649-152414671 CCTCGAACTCTCCAGATGCCAGG - Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
948180175 2:235973316-235973338 TCTGGAAAGTTACAGAAGCAGGG + Intronic
948408872 2:237743628-237743650 CCTAGAATGTTCCAGAAACAGGG + Intronic
1170738129 20:19028123-19028145 CCAGGAAAGCTCCAGGAGCCTGG - Intergenic
1175956157 20:62610445-62610467 CCTGGAAATTGCTAGAAGCCTGG - Intergenic
1178354716 21:31900979-31901001 CCACGGAAGTGCCAGAAGCTGGG - Intronic
1184876267 22:47277617-47277639 CGTGGAAAGTTCTAGATGCCTGG + Intergenic
953533220 3:43756570-43756592 TCTCAAAAGTGACAGAAGCCAGG + Intergenic
954369085 3:50160880-50160902 CCTCAGAAATTCCAGGAGCCGGG - Intronic
956056134 3:65300882-65300904 GGTGAAAAGTTCCAGAAGCCTGG - Intergenic
956063298 3:65370324-65370346 CTTTGTAAGTGCCAGAAGCCCGG - Intronic
957855133 3:85865199-85865221 CATAGAAAGTTCTTGAAGCCAGG - Intronic
960518607 3:118629698-118629720 CCTCAAAAGATCAAAAAGCCTGG - Intergenic
967110029 3:186284900-186284922 CTTAGACAGGTCCAGAAGCCAGG - Intronic
971024400 4:22574195-22574217 CCTCAAAAGATGAAGAAGCCAGG + Intergenic
971514647 4:27471242-27471264 CCTCAAAAGTAGCAGAAGACAGG + Intergenic
975367335 4:73544617-73544639 CCTGGAAAGGGCCTGAAGCCAGG + Intergenic
977234347 4:94489268-94489290 CCTGTAAAGTTCCAGAACCAGGG - Intronic
981547835 4:145912713-145912735 CCTAGAAACTACCAGAAGCTGGG + Intronic
981568920 4:146131398-146131420 CCTCAGAACTTCCAGCAGCCTGG + Intergenic
981880419 4:149604568-149604590 CTTAGAAAGTTCTAGTAGCCAGG - Intergenic
983817779 4:172153885-172153907 CCTTGAAAGGTCAAGAGGCCTGG - Intronic
985656189 5:1132622-1132644 CCTGGAATGGTCCAGAAGGCAGG - Intergenic
986770006 5:10964226-10964248 CCTAGGAAGTAACAGAAGCCTGG - Intergenic
988974188 5:36499160-36499182 CCTAAAATGTTCCAGAAGGCAGG + Intergenic
993801013 5:92337143-92337165 GCTCGAAAGCTGCAGAAGCTAGG - Intergenic
995484949 5:112630552-112630574 CCTGGAATGTTCCAGACGACAGG - Intergenic
995586836 5:113656534-113656556 CCTGGTAAGTCCCAGAAGTCTGG + Intergenic
997529766 5:134574743-134574765 CCTGGAAAGCTCCAGCAGCCAGG - Intronic
997844639 5:137275682-137275704 TCTGGAAAGCTCCAGAAGCTGGG - Intronic
999474068 5:151881913-151881935 CCTGGAAAGTTTCTGAAACCCGG + Intronic
1000957100 5:167556317-167556339 CCTCTAAAGTTTTAGAATCCAGG - Intronic
1003777954 6:9390380-9390402 CCTAGAAAGTTCCAGAGGACAGG - Intergenic
1004179658 6:13370181-13370203 TCTTGAAAGCTTCAGAAGCCCGG + Intronic
1005378198 6:25207128-25207150 CCCGGAAAGTGCCAGAAGCCAGG + Intergenic
1015842078 6:137487749-137487771 CCTGGAAAATTGCGGAAGCCGGG - Intergenic
1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG + Intergenic
1019221329 6:170475147-170475169 TGTTGGAAGTTCCAGAAGCCTGG + Intergenic
1019852633 7:3574710-3574732 CTTCTAAATTTCAAGAAGCCAGG - Intronic
1023933792 7:44724575-44724597 CCTCGAAAATTCTTGAGGCCGGG + Intergenic
1029476821 7:100790000-100790022 CCTCTCCAGTTCCAGAAGCTGGG - Intronic
1031589632 7:123573687-123573709 CCTGGAAGGATACAGAAGCCAGG - Intronic
1033213211 7:139475787-139475809 ACTCAGAAGTTCCAGAGGCCTGG + Intronic
1034343210 7:150370987-150371009 CCTGGAAACTTCCAGAAGGGAGG - Intronic
1034405792 7:150901667-150901689 CCTCCACAGTTCCCCAAGCCTGG - Intergenic
1034506728 7:151498166-151498188 CCTTGAAGGTTCCTCAAGCCAGG - Intronic
1036627031 8:10480586-10480608 CCAAGAATGTACCAGAAGCCAGG + Intergenic
1037754660 8:21703074-21703096 CCTGGAATGGTCCAGAAGCCAGG + Intronic
1045598305 8:103683194-103683216 GCTCAGAAGTTCAAGAAGCCTGG + Intronic
1048589764 8:135810570-135810592 CCTCCATAGTTCCATAAGACAGG + Intergenic
1049217351 8:141414379-141414401 CCACTACAGTCCCAGAAGCCAGG - Intronic
1049482761 8:142834771-142834793 CCCCGAAAGTTCCAGAAAGCGGG + Intronic
1051875729 9:21791221-21791243 AGTCCGAAGTTCCAGAAGCCTGG + Intergenic
1056410308 9:86319593-86319615 CCTAGAAAGTTTCATAAGACAGG - Exonic
1060995944 9:127874995-127875017 CCTCGAAACTCCCAGAAAACAGG + Intronic
1061149329 9:128820090-128820112 CCTCGAAACTGCCTGAAGGCAGG - Exonic
1062170230 9:135130842-135130864 ACTGGAAGGTGCCAGAAGCCGGG - Intergenic
1062678928 9:137765880-137765902 CCTCGAAGCTTCCAACAGCCTGG - Intronic
1185505533 X:630350-630372 CCTGGAAAGATCCAGGCGCCGGG + Intronic
1186345457 X:8687304-8687326 CTTGGAAAGTTCCAGATGCCTGG + Intronic
1187795732 X:23001963-23001985 CCTGGAATCTTCCAGTAGCCTGG - Exonic
1188163811 X:26836200-26836222 GCTAGAAAGTACCAGAAGCTAGG - Intergenic
1189375554 X:40463879-40463901 CCTAGAAACTACCAGAAGCTAGG - Intergenic
1190810562 X:53879390-53879412 CCTTAAGAGTTCCAGCAGCCTGG - Intergenic
1199854027 X:151745095-151745117 CCTGGAATGGACCAGAAGCCGGG - Exonic