ID: 900122417

View in Genome Browser
Species Human (GRCh38)
Location 1:1054466-1054488
Sequence GGGCCTCATTGCCCACCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900122417_900122423 2 Left 900122417 1:1054466-1054488 CCTGCAGGTGGGCAATGAGGCCC 0: 1
1: 0
2: 1
3: 19
4: 226
Right 900122423 1:1054491-1054513 GTGACCGGCTCCTCCCCGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 98
900122417_900122430 26 Left 900122417 1:1054466-1054488 CCTGCAGGTGGGCAATGAGGCCC 0: 1
1: 0
2: 1
3: 19
4: 226
Right 900122430 1:1054515-1054537 GCCACGCAGCTGGACACTGATGG 0: 1
1: 0
2: 1
3: 15
4: 162
900122417_900122428 16 Left 900122417 1:1054466-1054488 CCTGCAGGTGGGCAATGAGGCCC 0: 1
1: 0
2: 1
3: 19
4: 226
Right 900122428 1:1054505-1054527 CCCGCTGGGCGCCACGCAGCTGG 0: 1
1: 0
2: 1
3: 10
4: 126
900122417_900122422 1 Left 900122417 1:1054466-1054488 CCTGCAGGTGGGCAATGAGGCCC 0: 1
1: 0
2: 1
3: 19
4: 226
Right 900122422 1:1054490-1054512 TGTGACCGGCTCCTCCCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900122417 Original CRISPR GGGCCTCATTGCCCACCTGC AGG (reversed) Exonic
900117841 1:1036045-1036067 GGTGCTCCTTCCCCACCTGCTGG - Intronic
900122417 1:1054466-1054488 GGGCCTCATTGCCCACCTGCAGG - Exonic
901559454 1:10058663-10058685 AGGCACCCTTGCCCACCTGCAGG - Intronic
901928255 1:12580591-12580613 GGCACTCAGTGCCCATCTGCCGG + Exonic
903475016 1:23613489-23613511 GGGCCTCATAGGCCACCTTCAGG + Intronic
904006133 1:27364226-27364248 GGGCCGGCTTGCCCGCCTGCTGG - Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
905180277 1:36161185-36161207 GTGCCCCACTGCCCAACTGCTGG + Intronic
906157480 1:43622203-43622225 GGGCCACAGTGCCTGCCTGCTGG - Exonic
906723199 1:48024041-48024063 GAGCCACATTTACCACCTGCCGG + Intergenic
909392153 1:75131027-75131049 GGCCCTCACCGCCCACCTCCAGG - Intronic
910252750 1:85215368-85215390 GGGCCCCAGTGCCCACTTCCAGG - Intergenic
910540517 1:88350812-88350834 TGGGCTCTTTGCCTACCTGCTGG - Intergenic
915400046 1:155615580-155615602 GGGTCTTATTTCCCAGCTGCTGG + Intergenic
915417252 1:155751775-155751797 GGGTCTTATTTCCCAGCTGCTGG + Exonic
915467592 1:156106503-156106525 GGCCCTCGCTGCCCGCCTGCGGG + Intronic
918399716 1:184151589-184151611 TGGCCTCATTGCCCTTCTGAAGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920877936 1:209854748-209854770 GAGCCTCATTGTCCAACTGCAGG + Exonic
922236200 1:223724361-223724383 TGGCCTCACTGCACACCTGCTGG - Intronic
1063133422 10:3197143-3197165 GGGCCTGAGGACCCACCTGCAGG - Intergenic
1065208701 10:23381773-23381795 GGGACTCATTCCACAGCTGCTGG - Intergenic
1065845035 10:29736717-29736739 CGCCCTCCTCGCCCACCTGCCGG + Intronic
1067706597 10:48610903-48610925 AGGACTCACTGCCCAACTGCAGG - Intronic
1069839073 10:71327923-71327945 GGGCCTCCTTGCCCTCCCCCAGG + Intronic
1069855641 10:71439552-71439574 GGTCCTCTTTGCCCTCCTGGGGG - Intronic
1070636751 10:78134651-78134673 GAGCTTCCTTGCCCACCTGTGGG + Intergenic
1070829790 10:79411342-79411364 GAGCCTATTTGCTCACCTGCAGG - Intronic
1070961880 10:80505238-80505260 GGGCCTCCTTGCCCAGCCTCAGG + Intronic
1072416378 10:95249956-95249978 TGGCCTCTTCCCCCACCTGCAGG + Intronic
1073938578 10:108665471-108665493 GGGCCTCAGTGCCCACTGCCTGG + Intergenic
1074981954 10:118627006-118627028 GGGCCCCATTGACCTCCAGCTGG - Intergenic
1076141391 10:128081220-128081242 GGGCCACTGTGCTCACCTGCAGG - Intronic
1076878173 10:133227056-133227078 GGGCCACAAGCCCCACCTGCAGG - Intergenic
1077014314 11:393142-393164 GGGCCTCAGAGCCCATTTGCTGG + Intronic
1077080899 11:724351-724373 GGCCCTCACTGGCCAGCTGCGGG + Intronic
1077210477 11:1368987-1369009 CGGCCTCCAAGCCCACCTGCTGG + Intergenic
1077640604 11:3878126-3878148 TGTCCTCATTGCCCTCCTTCGGG + Intronic
1079375427 11:19887745-19887767 GGTCCTCTCTGCCCAGCTGCTGG + Intronic
1079404199 11:20130757-20130779 GGGACTCATTTCCCATCTGCGGG + Intergenic
1081731898 11:45377545-45377567 AGCCATCATGGCCCACCTGCTGG + Intergenic
1081915927 11:46730255-46730277 GGGCATCATTGCACTCCAGCTGG + Intronic
1081966823 11:47175202-47175224 GGGCCGCACTCCCCAGCTGCCGG + Exonic
1089462677 11:118662167-118662189 GGTCCTCATCCCTCACCTGCCGG + Intronic
1089614808 11:119689273-119689295 GGGCCTGATTGCAGACTTGCAGG + Intronic
1089621061 11:119722509-119722531 GGGCACCATTGCCCATCTGGAGG - Intronic
1089925091 11:122248823-122248845 GGGCCTCTTCACCCACCTGTGGG - Intergenic
1092148623 12:6232080-6232102 GGGCCTCTTTGCCCTGTTGCTGG - Intronic
1093566586 12:20613493-20613515 CGGCCTCATTACCGACCTCCTGG + Exonic
1094209904 12:27878086-27878108 AGGCCTTGTTGCCCAGCTGCTGG - Intergenic
1096479234 12:51926933-51926955 AGGCCTCATCACCCACCTGGTGG - Intergenic
1097573107 12:61356931-61356953 GGGCCGACTTGCCCACCTGTGGG - Intergenic
1102346160 12:112162645-112162667 GGCCCTCATCCCCCTCCTGCTGG - Intronic
1102469506 12:113151820-113151842 GTGCCCCATTAGCCACCTGCTGG - Intronic
1103575333 12:121873237-121873259 AGGCCTCAATGCCCAGCTGTAGG + Intergenic
1103646821 12:122400426-122400448 GGGCTTCATTTCCCACGTACTGG + Intronic
1103704186 12:122862516-122862538 GCGCCCCACTGCCCACCTGAAGG + Exonic
1103938223 12:124487621-124487643 GGGCCTCATAGCCTAGCCGCAGG - Intronic
1104477373 12:129081887-129081909 GGGACACCTGGCCCACCTGCTGG - Exonic
1104774053 12:131382014-131382036 CGGCCTCCGTGCCCACCTCCTGG + Intergenic
1105538193 13:21289658-21289680 GGGCATCATAGCCCTCTTGCAGG - Intergenic
1106330133 13:28732407-28732429 AAGCCTCATTTCCCAGCTGCTGG - Intergenic
1113588372 13:111481109-111481131 GGCCCCCGTTGCCCAGCTGCCGG + Intergenic
1114349041 14:21829678-21829700 GGGTCTCAGTGCTCACCTGTGGG + Intergenic
1114353283 14:21878365-21878387 AGGCCTCAGTGCTCACCTGTGGG + Intergenic
1114359106 14:21950258-21950280 GGGCCTCTGTGCTCACCTGTGGG + Intergenic
1117447526 14:55818924-55818946 GGGTCTCATGGGCCACCTGGTGG + Intergenic
1118299792 14:64605064-64605086 AGGCCTCTTTGCCCTGCTGCAGG - Intergenic
1119968784 14:78946372-78946394 TGGCCTGAGTGCCCACCAGCAGG + Intronic
1122059118 14:99124801-99124823 GGGCAGCATTTCCCACCTGTGGG - Intergenic
1122585784 14:102805581-102805603 GTGCCTCACTGCTCACCAGCAGG - Intronic
1122973426 14:105161562-105161584 GGGCCTCACCGCCCGCCAGCTGG + Intronic
1123058972 14:105585901-105585923 GGGCCTCACTGCCCCCTTGTGGG + Intergenic
1124006886 15:25801756-25801778 TGGCATCACAGCCCACCTGCTGG + Intronic
1124899529 15:33809391-33809413 GGGCCTCAGTGGGCACTTGCTGG - Intronic
1125721328 15:41846529-41846551 GGGACCCAGGGCCCACCTGCAGG + Intronic
1125734687 15:41916406-41916428 TGTCCTCATTTCCCACCTGAGGG - Intronic
1126041828 15:44598811-44598833 AGGCTTCATTGCCTACTTGCTGG + Exonic
1126175697 15:45733300-45733322 GGGCCCCTTTGCCCACCCTCAGG - Intergenic
1132021771 15:98368672-98368694 GGGTGTCAGTGCACACCTGCAGG - Intergenic
1132617282 16:847916-847938 GGGCCTCCGTGCCCACCCCCAGG - Intergenic
1132897000 16:2233878-2233900 AGGCCTCGCTGGCCACCTGCTGG - Exonic
1132898938 16:2243115-2243137 GGTCCACTATGCCCACCTGCAGG + Exonic
1133305292 16:4804506-4804528 GGGCCTCCATGCTCACCTGCAGG + Exonic
1133956300 16:10446872-10446894 GAGGCTCAATGCCCCCCTGCTGG + Intronic
1136186891 16:28593553-28593575 GGGCAACATAGACCACCTGCAGG + Exonic
1136189475 16:28607062-28607084 GGGCAACATAGACCACCTGCAGG + Exonic
1136317555 16:29463338-29463360 GGGCAACATAGACCACCTGCAGG - Exonic
1136432130 16:30202683-30202705 GGGCAACATAGACCACCTGCAGG - Exonic
1138300137 16:55919142-55919164 GGGACTCATTGCCCAGCAGAAGG - Intronic
1139062221 16:63265988-63266010 GGGACTCATTGTCCAACTGTGGG + Intergenic
1140457790 16:75114851-75114873 AGCCCTCAACGCCCACCTGCGGG - Exonic
1141503296 16:84459413-84459435 GTGTCTCTTTACCCACCTGCGGG + Intronic
1145306107 17:21676137-21676159 GGTGCTCATTGTCCACCCGCAGG - Intergenic
1145370557 17:22303342-22303364 GGTGCTCATTGTCCACCCGCAGG + Intergenic
1146470885 17:33123811-33123833 CTGCCTCATTACACACCTGCTGG + Intronic
1146650157 17:34601611-34601633 GGCCCTGATGGCCCAGCTGCTGG - Intronic
1147558861 17:41496855-41496877 GTGCCTCAATGGCCACCTGCTGG - Intergenic
1148327997 17:46795130-46795152 GGCCCTCATTTCCCACCCTCGGG + Intronic
1148789414 17:50165113-50165135 GGGCCACCTTGGCCACTTGCTGG - Intronic
1150809229 17:68343648-68343670 GGGCTTCCTTGCTCACCGGCCGG + Exonic
1152862191 17:82702950-82702972 GGGGATCAGTGCCCACCTCCGGG + Intergenic
1154074738 18:11188974-11188996 GGAGCTCATTGTCCTCCTGCAGG - Intergenic
1154496001 18:14961748-14961770 GGGACACACTGCCCACTTGCTGG + Intergenic
1155363681 18:25029363-25029385 GTGCCCCAATGCCCAGCTGCTGG + Intergenic
1155488500 18:26373016-26373038 GGGACTCATTGCTCACCTTCTGG - Intronic
1160028880 18:75241500-75241522 AGGCTTCCTTGCCCACCTGCAGG - Intronic
1162348320 19:10134292-10134314 GCACGGCATTGCCCACCTGCAGG + Exonic
1163193511 19:15697153-15697175 GGGCCTCACTGACAGCCTGCAGG + Exonic
1163644326 19:18479852-18479874 GGGCCTCATTGTCCCCAGGCTGG - Intronic
1164809328 19:31143714-31143736 GGGACTCGCTGCCCAACTGCAGG + Intergenic
1165509635 19:36258513-36258535 GGGGCTCATTGTCCACCCGCAGG + Intergenic
1165511157 19:36267476-36267498 GGGGCTCATTGTCCACCAGCAGG + Intergenic
1165624105 19:37270613-37270635 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165624651 19:37273155-37273177 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165625194 19:37275681-37275703 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165625728 19:37278219-37278241 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165626268 19:37280747-37280769 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165626807 19:37283274-37283296 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165627349 19:37285792-37285814 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165627890 19:37288320-37288342 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165628427 19:37290844-37290866 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165628964 19:37293372-37293394 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165629510 19:37295895-37295917 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165630051 19:37298420-37298442 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165630594 19:37300948-37300970 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1165631128 19:37303489-37303511 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1167790527 19:51676032-51676054 GGGCCTCATTACCCAGAAGCAGG + Intergenic
925180978 2:1816815-1816837 GGGCCTCACTGCCCGGCTGGGGG + Intronic
925644210 2:6019584-6019606 GGGCCTCATTGCCAACTCCCTGG - Intergenic
926243795 2:11107249-11107271 GGTCCTCAGTGACCACGTGCTGG - Intergenic
932602108 2:73134753-73134775 GGGCATCATTGCTCAGCTCCAGG + Intronic
933697980 2:85234599-85234621 GGACCACATTCCCCATCTGCTGG + Intronic
937311590 2:120906276-120906298 GGGCCTCATCACCCACCTGCTGG - Intronic
938987424 2:136591734-136591756 GGGCATCTTCACCCACCTGCAGG + Intergenic
940896493 2:159086058-159086080 TGGCCTCATTGCACAGCTCCGGG + Intronic
942556544 2:177177911-177177933 TGGCCTCATTGCAGGCCTGCTGG - Intergenic
942612751 2:177758734-177758756 GTGCCTCCTTGGCCACCCGCCGG + Intronic
943701967 2:190996562-190996584 GGGCCTCCCTGGCCACCTGAAGG + Intronic
946008015 2:216541915-216541937 GGGCCTCATTGCTCAGTGGCTGG - Intronic
947866358 2:233400474-233400496 GGGCCTCCCTGGCCACCTGCTGG + Intronic
948931843 2:241137081-241137103 TGGCCTCATCACCCTCCTGCCGG - Exonic
949046938 2:241876680-241876702 GGGCCTCAGGGGCCAACTGCAGG + Intergenic
1169122731 20:3107067-3107089 GGGCCTCGCAGCCCAGCTGCAGG + Intergenic
1169139391 20:3218495-3218517 AGCCCTCACTGCCCACCCGCAGG + Exonic
1170574575 20:17652713-17652735 GTGCCTCGTTGCCCCTCTGCTGG - Intronic
1171183407 20:23107710-23107732 GAGCCTCACTGACCAGCTGCAGG - Intergenic
1171531356 20:25855598-25855620 GGTGCTCATTGTCCACCTGCAGG - Intronic
1172150560 20:32787382-32787404 GGGACTCCATGCCCCCCTGCTGG - Exonic
1172357862 20:34292290-34292312 GGGCCTGTTTGCCCACATGATGG - Intronic
1173116037 20:40243994-40244016 GGGCCTCATTGACCTCTTGGAGG + Intergenic
1173478965 20:43384228-43384250 GGGTCTCACTGTCCATCTGCTGG + Intergenic
1174107288 20:48171796-48171818 GGGCCCCAAAGCCCCCCTGCTGG + Intergenic
1175196827 20:57249848-57249870 GGGGCTCAGTCCTCACCTGCAGG - Intronic
1176233144 20:64042101-64042123 GGGCCTCCCTGCACACCTGCAGG - Intronic
1178340094 21:31778829-31778851 CTGCCTGACTGCCCACCTGCTGG - Intergenic
1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG + Intronic
1179953800 21:44726951-44726973 AGCCCTCATGACCCACCTGCTGG + Intergenic
1180086964 21:45512027-45512049 GGGCCACATGGCCTCCCTGCTGG - Intronic
1180225274 21:46388430-46388452 CGGCCACATCGCACACCTGCGGG + Intronic
1180624985 22:17188432-17188454 TGTCCTCATGCCCCACCTGCAGG + Exonic
1182114944 22:27750972-27750994 GAGCCTCCGTGCCCACCTGGCGG - Exonic
1183544704 22:38449219-38449241 GACCCTCATTGGCCACCTGAAGG - Intronic
1183742629 22:39677334-39677356 GGCCCAGGTTGCCCACCTGCGGG - Exonic
1183897818 22:40983246-40983268 GGGCTTCTTAGTCCACCTGCAGG - Intergenic
1184189013 22:42882572-42882594 GGCCCACACAGCCCACCTGCTGG - Intronic
1184506914 22:44909383-44909405 GGGCCTCACAGTGCACCTGCAGG + Intronic
1185382703 22:50517512-50517534 GGGCCTCCCTGGCCACATGCAGG - Intronic
950453440 3:13078596-13078618 GGGCATCTATGTCCACCTGCAGG + Intergenic
954434796 3:50490302-50490324 GAGCCTCAGTGCCCCCTTGCTGG + Intronic
955644129 3:61118564-61118586 GGACCTCATTCCACACCTGTAGG + Intronic
956245349 3:67176396-67176418 GGCCCTCATAGCCCCTCTGCTGG + Intergenic
956718549 3:72099021-72099043 GGGACTGATTGCCCCCCTGTTGG - Intergenic
962865468 3:139444922-139444944 TGGCCTCATTGCAGACCCGCTGG - Intergenic
968750687 4:2387380-2387402 TGGCCTGCTTGCCCTCCTGCCGG + Intronic
969318192 4:6394795-6394817 GGCCCCCATCGCCCGCCTGCCGG - Intronic
969485894 4:7472264-7472286 GGGGCACTTTCCCCACCTGCTGG + Intronic
980354212 4:131723443-131723465 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980354752 4:131725949-131725971 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980355286 4:131728426-131728448 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980356909 4:131735906-131735928 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980357449 4:131738398-131738420 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980357988 4:131740887-131740909 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980359063 4:131745851-131745873 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980359601 4:131748322-131748344 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980360683 4:131753289-131753311 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980361226 4:131755769-131755791 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980361766 4:131758244-131758266 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980362309 4:131760724-131760746 GGCGCTCATTGTCCACCCGCAGG + Intergenic
980362852 4:131763207-131763229 GGCGCTCATTGTCCACCCGCAGG + Intergenic
982436839 4:155389845-155389867 GGCCCTCATTCCCCAGCTGCTGG + Intergenic
983183964 4:164679836-164679858 GGGTCTCATAAGCCACCTGCAGG - Intergenic
985342965 4:188973942-188973964 GGACATCATTCCCCACCTGTAGG - Intergenic
985343072 4:188974262-188974284 GGACATCATTCCCCACCTGTAGG - Intergenic
985343187 4:188974625-188974647 GGACATCATTCCCCACCTGTAGG - Intergenic
985780488 5:1868396-1868418 GGTACTCATTGTCCATCTGCAGG - Intergenic
985889833 5:2706560-2706582 GGGACGCCTTGCCCTCCTGCAGG - Intergenic
985956284 5:3268501-3268523 GGGCCACATTGGCCACCTCCAGG + Intergenic
997590073 5:135067023-135067045 GGGCCACCCTGCCCACCTCCAGG + Intronic
998155667 5:139785520-139785542 GGCCCTCATTGCCTTCCTGATGG + Intergenic
999197354 5:149791492-149791514 GGAGCTCCTTGCACACCTGCAGG - Intronic
1002041847 5:176520507-176520529 GGGCTCCAGTGCACACCTGCAGG - Intergenic
1005990153 6:30897514-30897536 GTTCCTCAGTGCCCACCAGCTGG + Exonic
1006021709 6:31121341-31121363 TGGCCCCATAGCCCATCTGCTGG + Intronic
1007256047 6:40529443-40529465 AGCCCACATTGACCACCTGCAGG - Intronic
1007785331 6:44276437-44276459 GGTCCTCATCGTCCACCGGCAGG + Exonic
1014088359 6:117373427-117373449 GGGCCTCAGCGCCTCCCTGCGGG - Intronic
1014535721 6:122610827-122610849 GGTCATCAATGGCCACCTGCAGG - Intronic
1019151880 6:170011754-170011776 TGGCTTCATTGCTCATCTGCTGG - Intergenic
1019402477 7:863714-863736 GGGCCTGAGAGCTCACCTGCTGG + Intronic
1023778578 7:43634550-43634572 GGGCCTCATTACCATCCTGCAGG + Intronic
1024669925 7:51585088-51585110 GGGCCACATTGCGCAGTTGCAGG + Intergenic
1026455013 7:70563665-70563687 CTGCCTTACTGCCCACCTGCAGG + Intronic
1029920032 7:104253087-104253109 GGGCATCATGGCCCACCTCAGGG + Intergenic
1032383196 7:131504617-131504639 GGCCCTCATTGCTCGCCTGTGGG + Intronic
1035428040 7:158795122-158795144 AGGCAACATTGCCCAGCTGCCGG + Intronic
1035665390 8:1376415-1376437 TGGCCTCTGTGCCCACCTGCTGG + Intergenic
1035786254 8:2263559-2263581 TGGCCTCTGTCCCCACCTGCAGG + Intergenic
1035806553 8:2458157-2458179 TGGCCTCTGTCCCCACCTGCAGG - Intergenic
1039475607 8:37837909-37837931 CGGCCACATTGCCCAAGTGCTGG - Exonic
1044946956 8:97398199-97398221 GGCACTCATTCCCCAGCTGCTGG - Intergenic
1045211592 8:100105750-100105772 GGGCTTCACTGCCCTCCTGTTGG - Intronic
1049659743 8:143814572-143814594 GGTCCTCTGTGGCCACCTGCAGG - Intronic
1049693935 8:143974583-143974605 GGGCCTCCCTGCCCTCCGGCTGG + Intronic
1049777939 8:144415066-144415088 GGGCCTCCCTGCCCACCCCCAGG + Exonic
1050595409 9:7199829-7199851 GTACTTCATTGCTCACCTGCTGG + Intergenic
1053642910 9:40105721-40105743 GGCGCTCATTGTCCACCCGCAGG - Intergenic
1053763243 9:41359769-41359791 GGCGCTCATTGTCCACCCGCAGG + Intergenic
1054541852 9:66270936-66270958 GGCGCTCATTGTCCACCCGCAGG + Intergenic
1056532191 9:87497805-87497827 GGTCCCCATTGGCCGCCTGCCGG + Intronic
1056702634 9:88923836-88923858 TGGCCTCATCGGCCACCCGCAGG - Intergenic
1057132209 9:92661917-92661939 GGGCCCCATTACCCTCATGCAGG + Intronic
1057216225 9:93230336-93230358 GGGCCTCAGTGCCCCTCAGCCGG + Intronic
1060201273 9:121652784-121652806 GGGCCACATTCCCACCCTGCAGG + Intronic
1060776218 9:126376747-126376769 CAGCCTCCTTCCCCACCTGCCGG + Intronic
1061456544 9:130702289-130702311 GGGCTTCATTGCAAACCTGGAGG + Exonic
1061634620 9:131899466-131899488 GGCCCTCATTCTCCACTTGCAGG + Intronic
1061834105 9:133317823-133317845 CGGCCTCATTGCTGCCCTGCAGG + Intergenic
1062145151 9:134984952-134984974 TGGCCTCACTGCCCAGCTGCAGG - Intergenic
1062177891 9:135174448-135174470 GGGCCTCCCTGCCCACCTCCTGG + Intergenic
1062237903 9:135521527-135521549 TGGCCTCATTGCTGCCCTGCAGG + Exonic
1062432303 9:136531627-136531649 GGGCATCGGTGCCCTCCTGCTGG - Intronic
1062460910 9:136662224-136662246 GGGCCTGCTTGCCCATCTCCAGG + Intronic
1062533450 9:137011539-137011561 GGGCGTGATGGACCACCTGCGGG + Exonic
1203785442 EBV:125043-125065 TGGCATCCTTGCCCACCAGCAGG + Intergenic
1188526926 X:31097290-31097312 TGGCCGCATTGTGCACCTGCAGG + Intergenic
1196160108 X:112473887-112473909 ATACCTAATTGCCCACCTGCTGG - Intergenic