ID: 900129127

View in Genome Browser
Species Human (GRCh38)
Location 1:1080216-1080238
Sequence AGGGGCGGCCCCAGCACGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900129127_900129139 19 Left 900129127 1:1080216-1080238 CCTGACGTGCTGGGGCCGCCCCT 0: 1
1: 0
2: 3
3: 9
4: 134
Right 900129139 1:1080258-1080280 CCTCCTGTGCCCAGTGAGGAGGG 0: 1
1: 0
2: 7
3: 32
4: 363
900129127_900129135 15 Left 900129127 1:1080216-1080238 CCTGACGTGCTGGGGCCGCCCCT 0: 1
1: 0
2: 3
3: 9
4: 134
Right 900129135 1:1080254-1080276 TGTCCCTCCTGTGCCCAGTGAGG 0: 1
1: 0
2: 2
3: 31
4: 328
900129127_900129137 18 Left 900129127 1:1080216-1080238 CCTGACGTGCTGGGGCCGCCCCT 0: 1
1: 0
2: 3
3: 9
4: 134
Right 900129137 1:1080257-1080279 CCCTCCTGTGCCCAGTGAGGAGG 0: 1
1: 0
2: 2
3: 44
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900129127 Original CRISPR AGGGGCGGCCCCAGCACGTC AGG (reversed) Intergenic
900129127 1:1080216-1080238 AGGGGCGGCCCCAGCACGTCAGG - Intergenic
904238618 1:29129800-29129822 AGGGGAGATCCCAGCACTTCGGG - Intergenic
904322537 1:29707114-29707136 AGGGGCGGCCCCAGGACGGTCGG + Intergenic
906214589 1:44031324-44031346 CGGTGCGGACCCAGCACGCCTGG - Intronic
915238495 1:154502561-154502583 AGGGGCGGCGGCCGCACGTGCGG + Intronic
920248179 1:204603902-204603924 AGGAGCTGCCCCAGCACCTCTGG - Intergenic
920639479 1:207737889-207737911 AGGAGAGGCTCCAGCACGGCTGG + Intronic
922764638 1:228150613-228150635 AGGGCCTGCCCCAGCACCCCGGG - Intronic
1064543343 10:16427107-16427129 AGGTGCGGCACCATCACGCCTGG + Intergenic
1065782838 10:29186630-29186652 AGGGGCCCCCACAGCACTTCAGG - Intergenic
1066144479 10:32541940-32541962 AGGTGAGGCACCAGCATGTCTGG - Intronic
1069386154 10:67884877-67884899 TGGGGCGGCCCCAGAGCGTGAGG + Exonic
1070779010 10:79126847-79126869 ATGGGCTTCCCCAGCACCTCGGG + Intronic
1074006579 10:109431436-109431458 AGGGGCTGGCCCAGCATGTGGGG + Intergenic
1076319798 10:129569499-129569521 AGGGGCCGTCCCAGCACGTCGGG - Intronic
1076579066 10:131494733-131494755 TGAGGCCTCCCCAGCACGTCTGG - Intergenic
1076684855 10:132193964-132193986 GGGGGCGGCCCAAGCCGGTCAGG + Intronic
1077107954 11:850001-850023 AGCGGCGGCCCCGGCACACCCGG + Intronic
1079346849 11:19660265-19660287 AGGGGCTGCCCCAGCAGGGCTGG + Intronic
1083266308 11:61548441-61548463 AGGGGCGCCACCAGCTCATCAGG + Intronic
1083305100 11:61757949-61757971 AGGGGTGGCTCCAGCACGGGTGG + Intronic
1083921641 11:65784234-65784256 AACGGCGGCCCCAGCACGCCAGG + Intergenic
1084592983 11:70101146-70101168 AGGTGGGGCCCCAGCACCTCAGG - Intronic
1090268627 11:125370567-125370589 CGCGGCTGCCCCAGCACCTCAGG + Intronic
1097679777 12:62637853-62637875 AGGGGCAGAGCCAGCACGGCCGG - Intergenic
1102546818 12:113663370-113663392 AGGGGAGGCCTCAGGAGGTCAGG - Intergenic
1104858954 12:131914968-131914990 AGGGGAGGCCCCAGCAGCCCAGG - Intronic
1105760925 13:23513809-23513831 AAGGGAGGCCCCAGCATGTGGGG + Intergenic
1112415588 13:99201033-99201055 AGGGTCGGCCCCACCACCTCCGG - Intronic
1112580872 13:100675134-100675156 AGGGGCGGCCCCAGCTGGGTCGG + Intergenic
1113610950 13:111644887-111644909 AGGGGCGGCCCCAGGCTGGCTGG + Intronic
1119793758 14:77377199-77377221 AGGGGCGGCCACAGGAGCTCTGG + Exonic
1121284905 14:92727561-92727583 AGGGGCGTGGCCAGCACATCGGG - Intronic
1121981794 14:98460896-98460918 AGGGGCAGCCCCAGGCCCTCTGG - Intergenic
1123018004 14:105384669-105384691 AGGGGCGGGCACAGCCCTTCAGG + Intronic
1124079649 15:26479738-26479760 AGGTGGGGCCTCAGCACATCTGG + Intergenic
1124440007 15:29678792-29678814 AGGTGGGGCCCCAGCAGCTCTGG + Intergenic
1126099944 15:45112949-45112971 AGCCACGGCCCCAGCACGCCCGG + Intronic
1128335167 15:66781061-66781083 AGAGGCGGCCCACGCGCGTCCGG - Exonic
1128392144 15:67189539-67189561 AGGGGCCGCGCCCGCCCGTCAGG - Intronic
1129705584 15:77792298-77792320 AGGCCCGGCCCCACCACCTCTGG + Intronic
1133032795 16:3019539-3019561 AGGCCCTGCCCCACCACGTCCGG - Intronic
1134225397 16:12386018-12386040 AGGGGCGGCCTCAGCTGGCCAGG + Intronic
1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG + Intronic
1138448247 16:57077990-57078012 AGGAGCTGCCCCAGCACCTGAGG + Exonic
1138658027 16:58501775-58501797 AGGGGCGGCCACACCAGGGCTGG + Intronic
1139655981 16:68387491-68387513 AGGGGCGGGGCCAGCACCTAAGG - Intronic
1140067877 16:71626058-71626080 GGGGGCGGCCTGAGCGCGTCTGG - Intergenic
1141695982 16:85619669-85619691 TGGGGCAGCCACAGCACCTCTGG - Intronic
1142177461 16:88651658-88651680 AGGGACGGCCCCGTCACGTCCGG + Intergenic
1142352562 16:89586848-89586870 CTGGTGGGCCCCAGCACGTCTGG + Intronic
1142418663 16:89957065-89957087 AGAGCCAGCCCCAGCACTTCTGG - Intronic
1142424292 16:89992768-89992790 AGGGCCGGGTCCAGGACGTCAGG - Intergenic
1147517945 17:41139986-41140008 AGGGGCGGCAGCAGCACGGGCGG + Exonic
1148388775 17:47254842-47254864 AGAGGCGGCCCCAGCAGACCAGG - Intronic
1148567032 17:48639425-48639447 AGGGGCGGAGCCAGAAGGTCGGG + Intergenic
1151546263 17:74795150-74795172 AGGGGCTTCCTCAGCAAGTCAGG + Intronic
1151856527 17:76726150-76726172 ACGGGCGGCCACAGCACGGGAGG + Intronic
1151994750 17:77601476-77601498 AGGGGCAGCCCCAGAAGGTGAGG - Intergenic
1152259398 17:79258912-79258934 AGGCGCCGTCCCAGCAAGTCTGG + Intronic
1152426357 17:80220601-80220623 ACGGGAGGCCCCCGCACTTCAGG - Intronic
1152528555 17:80903428-80903450 AGTGGCGGCCCCTGCACCCCAGG + Intronic
1153265224 18:3262527-3262549 AGGGCCGGCCCACGCACGGCCGG - Exonic
1160017813 18:75157795-75157817 AGGTGCGGCCCCTGCTCTTCTGG - Intergenic
1160868570 19:1266828-1266850 AGGGGCGAGCCCCGCGCGTCGGG + Intronic
1161323619 19:3652556-3652578 AGGGGAGGCCCCAGCCTGTCAGG - Intronic
1161738636 19:6007014-6007036 GGGACCGGCCTCAGCACGTCGGG + Exonic
1162767750 19:12930294-12930316 AGCGGCGGCTCCAGCTGGTCCGG - Exonic
1163271149 19:16254690-16254712 AGGAGGGGCCCCAGCAGGCCGGG + Intergenic
1163657805 19:18557903-18557925 AGCGGCGGCACCTGCACATCTGG - Intronic
1164061326 19:21678014-21678036 CGGGGCGGCTCCTGCACCTCTGG + Intergenic
1164402060 19:27909570-27909592 GTGGGCACCCCCAGCACGTCAGG - Intergenic
1164958403 19:32405991-32406013 AGGGGCGGCCCCAGGGGCTCGGG - Intronic
1166034102 19:40154820-40154842 AGGCGCGGTCCCAGCACTTTGGG + Intergenic
1167379415 19:49129861-49129883 AGGCATGGCCCCAGCACGACCGG + Intronic
1168276263 19:55280281-55280303 AGGGGCGGCGCCCGCACGAAGGG - Exonic
927109438 2:19853670-19853692 AGAGGCTGCCCCAGCATGGCAGG + Intergenic
928275059 2:29893083-29893105 AGGGGCGACAACAGCACATCAGG - Intronic
929539687 2:42810245-42810267 AGGAGCGGCCCCAGCGCCTGCGG - Intergenic
929568668 2:43006312-43006334 AGGGGCGGCCCCACCAGCCCCGG - Intergenic
929947425 2:46381624-46381646 ATGGCCGGACTCAGCACGTCTGG - Exonic
933684791 2:85134020-85134042 AGAGGCGCCCGCAGCCCGTCCGG + Exonic
933695153 2:85212201-85212223 AGGGGTGGCCACAGCCCATCTGG - Intronic
935387231 2:102512982-102513004 AGGGGAGGACCCAGCACGTCAGG + Intronic
936399424 2:112154449-112154471 AGGGGAGGCCCCTGCACACCAGG - Intronic
936924211 2:117720359-117720381 AGGGGCAGCCCCACAAGGTCAGG - Intergenic
944766814 2:202872085-202872107 AGGGGCCGCCCCAGAAGGCCCGG - Intergenic
948337143 2:237218277-237218299 AGGGGTGGCCCCATTACTTCTGG - Intergenic
948692868 2:239717926-239717948 GTGTGCGGCCCCAGGACGTCAGG + Intergenic
949045226 2:241869812-241869834 AGAGGAAGCCCCAGGACGTCTGG + Exonic
1172091298 20:32434744-32434766 AGGGGAGGCCCGAGCACCCCTGG + Exonic
1173553348 20:43948621-43948643 AGAGGCTGCCCCAGCAGGCCCGG - Intronic
1174114538 20:48218005-48218027 GGGGGCTGCCCCAGCAGGCCAGG - Intergenic
1175858003 20:62133149-62133171 AGGGGCGGCCCCGTCAGCTCTGG - Intronic
1176031635 20:63015728-63015750 TGGGGCTGCCCCAGCGCGCCAGG - Intergenic
1176100362 20:63361731-63361753 AGGGGCACCCCTAGCACATCTGG + Intronic
1176129101 20:63488716-63488738 AGGGCCCACCCCAGCTCGTCTGG + Intronic
1176306055 21:5123683-5123705 GGTGGCAGCCCCAGCACGGCCGG - Intronic
1179851002 21:44138348-44138370 GGTGGCAGCCCCAGCACGGCCGG + Intronic
1181831657 22:25564938-25564960 CGGGGCGGCCCCCCCAGGTCGGG + Exonic
1183370200 22:37427724-37427746 AGGCGCGGCCCCAGCCCCGCGGG - Intergenic
1185369751 22:50455591-50455613 ACAGGCGGCCTCAGCACCTCGGG + Intronic
950286807 3:11751511-11751533 AGGCCTGGCCCCAGCACGGCAGG - Intergenic
950438473 3:12994127-12994149 CGGCGCGGCCCCAGAGCGTCCGG + Intronic
952327349 3:32333432-32333454 AGGTGCTGACCCAGCAGGTCTGG - Intronic
961458668 3:127036782-127036804 AGTGGCGGCAGCAGCACGCCAGG - Exonic
961532552 3:127548036-127548058 TGGGGGGGCCGCAGAACGTCGGG + Intergenic
966911834 3:184564130-184564152 CCGGGCCGCCCCAGCACATCAGG - Intronic
967892525 3:194373097-194373119 TGGGGCGACCCCAGCTCTTCCGG - Intergenic
968048209 3:195635562-195635584 AGGGGCGGCCCCAGGAGACCGGG - Intergenic
968099195 3:195954058-195954080 AGGGGCGGCCCCAGGAGACCGGG + Intergenic
968306402 3:197654359-197654381 AGGGGCGGCCCCAGGAGACCGGG + Intergenic
968548056 4:1208515-1208537 TCGGGCAGCCCCAGCACCTCAGG - Intronic
968640349 4:1711704-1711726 TGGGGCGGCCGCAGCAGGCCTGG - Intronic
968900054 4:3426677-3426699 AGGGCCGGCTCCTGCGCGTCAGG - Intronic
968916155 4:3497857-3497879 AGGGCTGGCCCCACCACCTCTGG - Intronic
968977064 4:3827596-3827618 AGGGGCGGCTCCACCCCGTGTGG + Intergenic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
985504701 5:272055-272077 AGGGGCGGCCCCAGGAGACCGGG - Intronic
985743412 5:1633540-1633562 AGGGGCGGCCCCAGGAGACCGGG + Intergenic
987088005 5:14487589-14487611 AGTGGCGGCCCCAGCAGCTGCGG + Exonic
995657624 5:114444568-114444590 AGTGGATGCCCCAGAACGTCAGG + Intronic
997280627 5:132642020-132642042 AGGGGTGGCCCCAGGCCTTCAGG - Intronic
1002033389 5:176447447-176447469 AGGGGCGGCGGCAGCACGTCAGG + Intergenic
1010001839 6:70956502-70956524 AGCGGCGGCGCCAGCACTTAGGG + Exonic
1013525288 6:110968436-110968458 ACGGGCGCCCCCACCACGCCTGG - Intergenic
1018457415 6:163964387-163964409 AAGAGCGTCCCCAGCACGTGAGG - Intergenic
1018995054 6:168704177-168704199 AGGGGCGGGCCCGCCACGTGGGG + Intergenic
1019167540 6:170108606-170108628 ATGGGCAGCCCCTGCACCTCTGG + Intergenic
1019170222 6:170129572-170129594 AGGGGCTGCTCCAGCAGGGCTGG - Intergenic
1019651599 7:2161974-2161996 GGGGGCGGCCCCCGCCCATCCGG + Intronic
1020013946 7:4820457-4820479 AGGGGCTGCCCCATCACGTGGGG + Intronic
1027421210 7:78019657-78019679 AGGGGCGGCCCGAGGCCGGCAGG - Exonic
1029098404 7:98107239-98107261 TGGCGCGGCCCCAGCACTGCCGG - Exonic
1034171403 7:149065802-149065824 AGGGGCGGCCCCCGTACGCGGGG + Intergenic
1034202052 7:149288864-149288886 AGGGGAGGCCCCAGCTCCCCAGG - Intronic
1035578673 8:725714-725736 AGGGTCGGCCCCAGCAGGGAAGG - Intronic
1039491787 8:37953206-37953228 AGGGGAGGCCCCAGAAGGACAGG + Intergenic
1047734582 8:127754202-127754224 TGAGGAGGCCCCAGCACCTCGGG - Intergenic
1047951498 8:129939460-129939482 GGGGGCGGGCCCAGCGCGCCTGG + Intronic
1048981134 8:139703825-139703847 GGGCGCGGCCCCAGGACGGCAGG + Intergenic
1049409113 8:142464641-142464663 AGCAGCCGCCCCAGCACGACGGG + Exonic
1053391605 9:37740236-37740258 AGGAGGGGCCCCAGCACCTGCGG + Exonic
1060811757 9:126614334-126614356 AGGCGCGGCCCCCGCAGGGCAGG - Intergenic
1060831974 9:126722774-126722796 AGGGGTGGCCCCACCAGGCCGGG - Intergenic
1062105943 9:134754844-134754866 AGGGCCTGCCCCAGCCTGTCTGG - Intronic
1187078943 X:15965649-15965671 AGGTGCGCCACCAGCACGCCTGG - Intergenic