ID: 900129686

View in Genome Browser
Species Human (GRCh38)
Location 1:1082087-1082109
Sequence TGCCCTGGCGCTGAGTCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 267}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900129686_900129694 11 Left 900129686 1:1082087-1082109 CCCCAGGACTCAGCGCCAGGGCA 0: 1
1: 0
2: 1
3: 28
4: 267
Right 900129694 1:1082121-1082143 TGCAGTGAGGCAGTGACTTGTGG 0: 1
1: 0
2: 2
3: 14
4: 276
900129686_900129692 -2 Left 900129686 1:1082087-1082109 CCCCAGGACTCAGCGCCAGGGCA 0: 1
1: 0
2: 1
3: 28
4: 267
Right 900129692 1:1082108-1082130 CAGCCTTGGCAGGTGCAGTGAGG 0: 1
1: 0
2: 5
3: 38
4: 313
900129686_900129695 12 Left 900129686 1:1082087-1082109 CCCCAGGACTCAGCGCCAGGGCA 0: 1
1: 0
2: 1
3: 28
4: 267
Right 900129695 1:1082122-1082144 GCAGTGAGGCAGTGACTTGTGGG 0: 1
1: 0
2: 2
3: 18
4: 249
900129686_900129699 25 Left 900129686 1:1082087-1082109 CCCCAGGACTCAGCGCCAGGGCA 0: 1
1: 0
2: 1
3: 28
4: 267
Right 900129699 1:1082135-1082157 GACTTGTGGGGGTTAGATGTGGG 0: 1
1: 0
2: 0
3: 10
4: 132
900129686_900129696 13 Left 900129686 1:1082087-1082109 CCCCAGGACTCAGCGCCAGGGCA 0: 1
1: 0
2: 1
3: 28
4: 267
Right 900129696 1:1082123-1082145 CAGTGAGGCAGTGACTTGTGGGG 0: 1
1: 0
2: 1
3: 27
4: 305
900129686_900129697 14 Left 900129686 1:1082087-1082109 CCCCAGGACTCAGCGCCAGGGCA 0: 1
1: 0
2: 1
3: 28
4: 267
Right 900129697 1:1082124-1082146 AGTGAGGCAGTGACTTGTGGGGG 0: 1
1: 0
2: 1
3: 34
4: 248
900129686_900129698 24 Left 900129686 1:1082087-1082109 CCCCAGGACTCAGCGCCAGGGCA 0: 1
1: 0
2: 1
3: 28
4: 267
Right 900129698 1:1082134-1082156 TGACTTGTGGGGGTTAGATGTGG 0: 1
1: 0
2: 0
3: 14
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900129686 Original CRISPR TGCCCTGGCGCTGAGTCCTG GGG (reversed) Exonic
900129686 1:1082087-1082109 TGCCCTGGCGCTGAGTCCTGGGG - Exonic
900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG + Intronic
900465763 1:2824777-2824799 TGCCCTGGAGCTGATGCCTGGGG + Intergenic
900716840 1:4150488-4150510 TGCCCTGACGCTGGGACCAGAGG - Intergenic
901031540 1:6310016-6310038 TGCCCTGAGGCTGTGACCTGTGG - Intronic
901079676 1:6576838-6576860 TGCCCTGGGAGTGAGCCCTGAGG + Intronic
901607265 1:10469013-10469035 AGACATGGTGCTGAGTCCTGGGG - Intronic
901629509 1:10641343-10641365 TGCCCTGGCCATAACTCCTGGGG + Intronic
901672015 1:10861666-10861688 GGCCGTGGGCCTGAGTCCTGAGG - Intergenic
902286647 1:15411665-15411687 TGGCCTGAGGCTGAGTCTTGGGG + Intronic
902384772 1:16070152-16070174 TGCCCTGGCCATGTGACCTGAGG + Intronic
903177426 1:21589343-21589365 TGCCCCACCCCTGAGTCCTGCGG - Intergenic
903703477 1:25267884-25267906 TGCCCGGGCGCTGGGTTCAGGGG - Intronic
903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG + Exonic
903712744 1:25338213-25338235 TGCCCGGGCGCTGGGTTCAGGGG - Exonic
903718768 1:25389014-25389036 TGCCATGGTGCTGGGTCTTGTGG - Exonic
904035072 1:27554568-27554590 AGCCATGGCCCTGAGTCCTCAGG - Intronic
904745304 1:32707100-32707122 TGTCCAGGAGCTGACTCCTGCGG + Intergenic
904797625 1:33069354-33069376 TGCCCTGGGGCTGGGTGCAGTGG + Intronic
905344291 1:37300980-37301002 TGCCCTGGGGCTGAGCCCTGTGG + Intergenic
905775158 1:40663594-40663616 TGCCCAGGTGCTGAGCTCTGTGG - Intronic
905791590 1:40792440-40792462 TGCTCCAGCGCTGAGACCTGAGG - Intronic
906885814 1:49647412-49647434 TGCACTGGCACTGGTTCCTGTGG - Intronic
908169053 1:61486958-61486980 TGGCCTGGCTCTGAGTCACGAGG - Intergenic
910727321 1:90352661-90352683 TGCCCTGTTGCTGAGTCCCTCGG + Intergenic
913396113 1:118374676-118374698 TGCTCTGCCGCTGAGATCTGTGG + Intergenic
915746439 1:158163236-158163258 AGCCCTGGCCCTGACCCCTGTGG - Intergenic
915938429 1:160102864-160102886 CGACCTGGCCCTGACTCCTGAGG + Intergenic
916854685 1:168737491-168737513 TCCCCTGGCTCTGTGGCCTGTGG + Intergenic
919778423 1:201208401-201208423 TGCCCTGGTGCTAAGGCCTCTGG + Exonic
919822445 1:201481813-201481835 TGCGCAGGAGCTGAGTCCTCAGG + Intergenic
920049940 1:203157816-203157838 TGCCAAGGAGCAGAGTCCTGAGG + Intronic
922313487 1:224419329-224419351 TGCCCTTTCACTGACTCCTGAGG + Intronic
923296613 1:232600752-232600774 TGCTCTGGAACTGAGTGCTGAGG - Intergenic
923542677 1:234899842-234899864 TGCCATGGCGCAGAGTCGTGGGG + Intergenic
1063371558 10:5525805-5525827 TGCCCTGGTGCTCGGTCCTAAGG - Exonic
1064248735 10:13690619-13690641 TGCCCTCGGGTTGAGTCATGGGG + Intronic
1064312518 10:14224054-14224076 TGCTCAGGCGAGGAGTCCTGTGG + Intronic
1065005479 10:21375903-21375925 TTCCCTGGAGCAGAGTCCTAGGG + Intergenic
1066421853 10:35271266-35271288 TGTCCTGGAGCTGATTCCTGGGG - Intronic
1069992327 10:72323286-72323308 TGGCCAGGGGCTGGGTCCTGCGG - Intergenic
1070406739 10:76104313-76104335 TTCCCTTGCTCTGTGTCCTGGGG + Intronic
1070733074 10:78845028-78845050 TGCCCTGGTCCTGATTCCTGTGG - Intergenic
1070803007 10:79254583-79254605 GGCCCTGGCTCTAATTCCTGTGG - Intronic
1071289333 10:84177183-84177205 TGCCCTCTCCCTGAGGCCTGGGG + Intronic
1071563158 10:86658451-86658473 AGCCCCTGCTCTGAGTCCTGGGG - Intronic
1073292523 10:102420309-102420331 AGCCCTGAAGCTGAGTCCAGAGG + Exonic
1073349878 10:102812178-102812200 GACCCTGGCCCTGAGGCCTGTGG + Intronic
1074317778 10:112375080-112375102 TCCCCTGGCCCTGAGCCCTTTGG + Intronic
1075206964 10:120456869-120456891 TGCCCTGGCGCGGAGCCCAGGGG + Intergenic
1075468732 10:122672139-122672161 TGCCCTGGGACTGAGCCATGTGG + Intergenic
1075520909 10:123143053-123143075 AGCCCTGCGGCTGGGTCCTGCGG - Intergenic
1075727495 10:124618069-124618091 TGCACTGGGGGTGAGGCCTGGGG + Exonic
1075741872 10:124701023-124701045 TACGCTGGCCCTGACTCCTGAGG + Intronic
1076644557 10:131943678-131943700 TGCCCAGGCACCGAGGCCTGCGG - Intronic
1076660793 10:132054830-132054852 AGCCCTGGCCCTGAGGCCTGGGG + Intergenic
1076905387 10:133358360-133358382 TGCCCTTGCGCTGTGGCCGGGGG + Intergenic
1076905530 10:133358862-133358884 GGCCCTGGCCCTCAGCCCTGAGG + Intergenic
1077230743 11:1457241-1457263 TGCCATGGCGGGGAGTCCCGAGG - Intronic
1077251175 11:1561410-1561432 CGCCCTGGCGGGGAGTCCAGGGG - Intronic
1077502719 11:2916616-2916638 TGGCCGGGCACTGAATCCTGCGG - Exonic
1077606272 11:3614934-3614956 TGCCCTCAGGCAGAGTCCTGAGG - Intergenic
1078932183 11:15921157-15921179 TGCCAGGGCCCTGAGTGCTGCGG - Intergenic
1081989797 11:47331782-47331804 AGCCCTGGCCCTTGGTCCTGGGG - Intronic
1083292808 11:61699284-61699306 TGCCCTGGAGCTAAGGCCAGGGG + Intronic
1083419873 11:62546659-62546681 TGCCCTGGGGCTGAGCCCTCAGG - Exonic
1083797778 11:65027588-65027610 AGCCCTTGGGGTGAGTCCTGGGG - Exonic
1085417499 11:76329112-76329134 GGCCCTGGAGCGGGGTCCTGGGG - Intergenic
1089126869 11:116182561-116182583 TGCCCTGCCACAGTGTCCTGGGG - Intergenic
1090884331 11:130862490-130862512 AGCCCTGGCGGTGAGGCATGTGG - Intergenic
1092448262 12:8578328-8578350 TTCACTTGCCCTGAGTCCTGGGG - Intergenic
1094061459 12:26318867-26318889 TGCCCTGGGGCAGCTTCCTGCGG + Intergenic
1094470209 12:30795946-30795968 TACCGCGGCGCTGGGTCCTGCGG - Intergenic
1094837020 12:34326846-34326868 AGCCCCTGCGCTGTGTCCTGGGG - Intergenic
1094845429 12:34359410-34359432 CAGCCTTGCGCTGAGTCCTGTGG + Intergenic
1100390285 12:94141340-94141362 TGCCCTCACTCTGAATCCTGAGG + Intergenic
1102263143 12:111457742-111457764 TGCCCTGGAGCAATGTCCTGAGG + Intronic
1102370791 12:112381578-112381600 TGCCCTGGAAGTGGGTCCTGGGG + Intronic
1102820171 12:115901868-115901890 TCTCCAGGTGCTGAGTCCTGGGG + Intergenic
1105773833 13:23638423-23638445 GGGCCAGGCGCTGAGGCCTGGGG + Intronic
1107143578 13:37032550-37032572 TACCCTGGCACTGGTTCCTGAGG - Intronic
1108679842 13:52770250-52770272 TGGCTTGGTGCTGAGTGCTGAGG - Intergenic
1112042013 13:95556085-95556107 TGCCATGGCACTCTGTCCTGGGG - Intronic
1112247335 13:97746977-97746999 TGGCCTGGGGCTGAGTCCCGAGG - Intergenic
1112506035 13:99975976-99975998 TGAGGTGGCGCTGAGTCCTGAGG + Intergenic
1114460834 14:22885166-22885188 TTCCCTGGTGCTGAGATCTGAGG + Intronic
1114528387 14:23380146-23380168 TGCCCTCTCCCTGCGTCCTGTGG - Intergenic
1114532469 14:23404461-23404483 TGCCCTGGCCCTGAGGAATGGGG + Intronic
1115516413 14:34189617-34189639 TGCCATGGAGTTTAGTCCTGTGG + Intronic
1118455945 14:65945900-65945922 TGCCCTGGGGGTGAGAGCTGTGG + Intergenic
1118730038 14:68659593-68659615 TGCCCCGGTGCAGTGTCCTGAGG - Intronic
1120261251 14:82188927-82188949 TGCGCTGGAGCTGGGTCATGGGG + Intergenic
1121020390 14:90576663-90576685 AGCCCTGGTCCTGACTCCTGGGG - Intronic
1121493235 14:94374953-94374975 GTCCCTGGTTCTGAGTCCTGTGG + Intergenic
1121775330 14:96587039-96587061 CCCCCTGGCCCTGAGCCCTGTGG - Intergenic
1122266555 14:100549459-100549481 AGCCCTGTCACTAAGTCCTGGGG + Intronic
1122269165 14:100560644-100560666 TGCCATGTCTCTGTGTCCTGGGG - Intronic
1123411661 15:20066007-20066029 TGCCCTGAGGCTGGGCCCTGGGG - Intergenic
1123521007 15:21073126-21073148 TGCCCTGAGGCTGGGCCCTGGGG - Intergenic
1124186560 15:27535116-27535138 TCCCTTGGCGCTCAGTGCTGTGG - Exonic
1124251275 15:28107634-28107656 GGCCCTGGCGCGGAGGCATGCGG - Intergenic
1125593767 15:40871944-40871966 AGCTCTGGCGCTGACACCTGGGG + Intergenic
1127217213 15:56835961-56835983 TGCCCTGGCCTTGTGTCCTAGGG - Intronic
1128237936 15:66080152-66080174 TGCCCAGCCCCTGAGTCCTGGGG - Intronic
1128444599 15:67747099-67747121 CACCCTGGCGCTGAGGCCTCAGG + Intronic
1128548557 15:68583438-68583460 TGCCCTGGCAAGGGGTCCTGGGG + Intronic
1129461605 15:75702649-75702671 TCCCCTGCCTCTGAGCCCTGGGG - Intronic
1129682316 15:77664729-77664751 GGCCCTCCCCCTGAGTCCTGAGG - Intronic
1130275693 15:82475264-82475286 AGCAGTGGCACTGAGTCCTGTGG - Intergenic
1130468052 15:84202656-84202678 AGCAGTGGCACTGAGTCCTGTGG - Intergenic
1130485675 15:84397036-84397058 AGCACTGGCACTGAGTCCCGTGG + Intergenic
1130496214 15:84470886-84470908 AGCAGTGGCACTGAGTCCTGTGG + Intergenic
1130590344 15:85207254-85207276 AGCAGTGGCACTGAGTCCTGTGG - Intergenic
1131259911 15:90882871-90882893 TGCCCTGGCCCTGAGGTGTGGGG + Exonic
1132045972 15:98563005-98563027 TGCTGTGGGGCTGAGACCTGGGG + Intergenic
1132481527 16:168675-168697 TGCCGTGGTGCTGTCTCCTGAGG + Intergenic
1132518511 16:376942-376964 GAGCCTGGCCCTGAGTCCTGGGG - Intronic
1132554427 16:566325-566347 TGGCCAGGCGCGGAGTGCTGTGG + Intergenic
1134450735 16:14361805-14361827 TTCCCTGGCACTCAGTCCTGTGG - Intergenic
1134479105 16:14602316-14602338 GGACCTGGGGCTGAATCCTGAGG - Intronic
1134536916 16:15033723-15033745 TGCTCTGGAGCTGTGTCCTGAGG + Intronic
1135771916 16:25224355-25224377 TGTGCAGGCGGTGAGTCCTGAGG + Exonic
1137366410 16:47863461-47863483 TGCCCTTGCCCTGAATCCTGAGG + Intergenic
1138250325 16:55497097-55497119 AGCCCTGGTGCAGAGCCCTGTGG - Intronic
1138388849 16:56655396-56655418 TGTCCTGGTTCTGAGGCCTGTGG - Intronic
1140831501 16:78755668-78755690 GGCCCTGGTGCAGGGTCCTGAGG - Intronic
1142277949 16:89132790-89132812 AGCCCAGGCTCTGAGTGCTGAGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142961187 17:3553432-3553454 CCCACTGGAGCTGAGTCCTGGGG - Intronic
1146595185 17:34162336-34162358 TGCCCTGAGCCTGATTCCTGAGG + Intronic
1147973118 17:44230586-44230608 TACCCTGGCACTGGTTCCTGTGG + Intergenic
1149929913 17:60741085-60741107 TACCTTGGTACTGAGTCCTGAGG + Intronic
1150281049 17:63929872-63929894 TGCCAAGGTGCTGAATCCTGCGG + Exonic
1152371103 17:79889115-79889137 TTCCCTGGCTCTGAGGCCTTTGG + Intergenic
1153026189 18:675146-675168 AGCCCTGGCCCTCAGGCCTGAGG + Intronic
1153304719 18:3621113-3621135 TGACCTGGGGCTGAGTTCAGTGG + Intronic
1156295786 18:35789738-35789760 TGCCCTGGAGATGAGTCTAGTGG + Intergenic
1160443715 18:78911946-78911968 TGGCCTGGGGCTGTGGCCTGAGG - Intergenic
1160716134 19:577676-577698 AGCCCTGGCTGGGAGTCCTGTGG + Intronic
1160761506 19:787738-787760 TGGCCTGGGGCTGGGCCCTGGGG - Intergenic
1161510853 19:4670247-4670269 GGCCGTGGCGCTGAGGCCGGCGG - Exonic
1162495723 19:11022323-11022345 TGCCCTGAGGGTGAGTTCTGAGG - Intronic
1162561295 19:11419359-11419381 TGGCCGGGCGCTGAGGCCAGAGG + Intergenic
1163405041 19:17116783-17116805 TGCCCTACAGCTGAGTGCTGAGG + Intronic
1164454830 19:28398377-28398399 TGCCCTGGCTCTGAGACTGGTGG - Intergenic
1166293956 19:41879825-41879847 TGAACTGGCGCTGAGCCCAGGGG + Intronic
1166684852 19:44790148-44790170 TGCCTTGGCTCAGAGGCCTGGGG + Intronic
1167034354 19:46985308-46985330 TGCCCTGGTGCTTAGGCCAGAGG + Intronic
925388113 2:3477073-3477095 TGCCCCAGCCCTGACTCCTGAGG - Intronic
925553397 2:5101370-5101392 TTCCCTGGTTCTGAGTCCTTTGG + Intergenic
925981421 2:9180409-9180431 GGGCCTGGCTCTGTGTCCTGGGG + Intergenic
927975569 2:27335868-27335890 TGTCCTGGCTTTGAGTCCTAGGG + Intronic
929055538 2:37873322-37873344 TGCCCTGGCCCTGTGCCCTTCGG + Intergenic
929498002 2:42463565-42463587 TGCCCTGGTGCTGGGTTATGAGG - Intronic
931114467 2:59149464-59149486 TGCTCTGGCACTGTTTCCTGTGG + Intergenic
931623294 2:64232446-64232468 TGCCCGAGGGCTGAGCCCTGGGG + Intergenic
935070379 2:99688765-99688787 TGCCCAGGCGCAGTGGCCTGAGG - Intronic
935579482 2:104744317-104744339 TGACACGGGGCTGAGTCCTGGGG - Intergenic
936074576 2:109393697-109393719 AGCCCTGTCGCTCAGTGCTGAGG + Intronic
937429234 2:121824664-121824686 TGCCCTGACACTAGGTCCTGGGG + Intergenic
937924151 2:127154663-127154685 GGCCAAGGAGCTGAGTCCTGGGG + Intergenic
939764340 2:146227415-146227437 TGCTCTGTCGCTCAGGCCTGAGG - Intergenic
939985308 2:148824433-148824455 TTCCCTGGTTCTGAGTCCTTTGG + Intergenic
942122011 2:172787168-172787190 TGCCCTTGCGCTGCAGCCTGGGG + Intronic
945142150 2:206698440-206698462 TGAGCAGGAGCTGAGTCCTGAGG + Intronic
946407237 2:219498209-219498231 CGCCCTGGCGCCGAGCCCGGGGG + Intronic
948880917 2:240856729-240856751 TGTTCTGGTGCTGTGTCCTGGGG - Intergenic
949000711 2:241611195-241611217 TGGCCTGGCTCAGAGGCCTGGGG + Intronic
949041288 2:241851084-241851106 TGCCCAGCCACTGAGGCCTGAGG - Exonic
1169837477 20:9896432-9896454 TACCCTGGTGCTGAATTCTGGGG + Intergenic
1171412856 20:24958325-24958347 TGCCCTGGTTCTGAGTCCTTGGG + Intronic
1172701452 20:36855925-36855947 TGCCCTGCCGGAGAGGCCTGGGG - Intronic
1174168837 20:48603944-48603966 TGCCCTGTGGCTGTGCCCTGTGG + Intergenic
1176007979 20:62876541-62876563 TGCCCTGCCACTGAGGGCTGAGG + Intergenic
1176297442 21:5081592-5081614 TGCCCTGGCACTGAGGACTCAGG - Intergenic
1176707253 21:10125693-10125715 AGCCCTTGCGCTGTGCCCTGGGG + Intergenic
1179607690 21:42527817-42527839 TGGCTTGACGCTGAATCCTGTGG + Intronic
1179616021 21:42583949-42583971 TGCCCTGGCCATGTGCCCTGTGG + Intergenic
1179856411 21:44164637-44164659 TGCCTGGGCCCTGAGTCCAGTGG + Intergenic
1179859587 21:44180356-44180378 TGCCCTGGCACTGAGGACTCAGG + Intergenic
1179924729 21:44528222-44528244 GGGCCTGTGGCTGAGTCCTGTGG + Intronic
1180993533 22:19953145-19953167 CGCCCAGGCCATGAGTCCTGAGG - Intronic
1181474844 22:23161705-23161727 TGCCCTGGAGCTGAGCCCGGTGG - Exonic
1181694268 22:24585140-24585162 AGGCCTGGGGCTGGGTCCTGAGG + Intronic
1182717007 22:32364889-32364911 AGTCCTGGGGCAGAGTCCTGGGG - Intronic
1184348700 22:43928904-43928926 TCTGCTAGCGCTGAGTCCTGGGG + Intronic
1184477800 22:44730797-44730819 TGGCCTGGCCCTGGGTCCTCTGG + Intronic
1184718209 22:46294030-46294052 AGGCCTGGGGCTGGGTCCTGGGG + Intergenic
1185058643 22:48594056-48594078 TTCCAGGGCGCTGAGGCCTGTGG + Intronic
1185287418 22:50008730-50008752 TGCCCTGTCCCTCACTCCTGGGG + Intronic
1185339839 22:50286351-50286373 TCCCCTGGGGCTGACTCCTGGGG + Intronic
952399132 3:32947753-32947775 AGCTCTGCAGCTGAGTCCTGTGG + Intergenic
953099171 3:39809207-39809229 TCTCCTGCCTCTGAGTCCTGGGG - Intronic
953755515 3:45642894-45642916 TGCCGTGGAGATGAGTGCTGTGG + Intronic
954379882 3:50213694-50213716 TGCACTGGCCCTGTGTCCAGGGG - Intronic
954755851 3:52839331-52839353 GCTCCTGGCGCTGAGTCCAGAGG + Exonic
954760655 3:52871290-52871312 TGCCCAGGGTGTGAGTCCTGTGG - Intronic
954876876 3:53808065-53808087 AGCCCTGGCGCTGCATACTGTGG - Intronic
955349330 3:58182378-58182400 TGCTCTGTGGATGAGTCCTGTGG - Intergenic
957841278 3:85673115-85673137 TCCCCTGGTGCTGTGTCCTTAGG - Intronic
960952736 3:123010155-123010177 GGACCTGGCCCTGAGCCCTGGGG - Intronic
961204085 3:125067166-125067188 TACACGGGTGCTGAGTCCTGTGG + Intergenic
961433246 3:126898122-126898144 TGACCTTGCACTGGGTCCTGCGG - Intronic
962603466 3:137012391-137012413 TGCCCAGTCACTGAGTCCAGGGG + Intergenic
966132829 3:176663577-176663599 TTCTCTGGGCCTGAGTCCTGAGG - Intergenic
966916599 3:184587714-184587736 TGCCCTGACCCTGACTACTGGGG + Intronic
969309809 4:6346715-6346737 GGCCCTGAGCCTGAGTCCTGGGG + Intronic
971182582 4:24343449-24343471 TGCCTTGTTGCTGCGTCCTGTGG - Intergenic
971591651 4:28476460-28476482 AGTCCTGGAACTGAGTCCTGGGG + Intergenic
972436382 4:39039537-39039559 GACCCTGGAGCTGAGTCTTGAGG + Intergenic
972836744 4:42880272-42880294 TGGACTGCCGCAGAGTCCTGGGG - Intergenic
973623677 4:52751134-52751156 GGCACAGGCGCTGCGTCCTGCGG - Intronic
975403933 4:73968236-73968258 TGCCCTGGAGATCTGTCCTGGGG - Intergenic
976488430 4:85638041-85638063 TGCCCTGGTGCTGATTACTAAGG - Intronic
977344999 4:95806654-95806676 TTCTCTAGCACTGAGTCCTGTGG - Intergenic
977666169 4:99649638-99649660 TCCCTTGGCCCTGAGTCCTGGGG - Exonic
980987456 4:139709494-139709516 TTCTCTGGAGCTGTGTCCTGAGG + Intronic
982202694 4:152975193-152975215 CGCCCTGGCGCCGAGCTCTGGGG - Exonic
983904616 4:173169726-173169748 TCCCCAGGCGCTGAGGGCTGGGG - Intronic
985530569 5:431500-431522 TGCCCTGGACCACAGTCCTGCGG - Intronic
985831856 5:2239789-2239811 AACACTGGCGCTGATTCCTGCGG - Intergenic
986549213 5:8934338-8934360 TGCCTTGAGGATGAGTCCTGGGG - Intergenic
988607289 5:32689617-32689639 CTTCCTGGCTCTGAGTCCTGGGG - Intronic
993899060 5:93572234-93572256 TGTCCTGGCGCTGGGGCCTGAGG + Intergenic
994759712 5:103836961-103836983 TGCCCTGGGGCTAAGCCCTCAGG - Intergenic
996540951 5:124629694-124629716 TGCCCAGGTCCTGTGTCCTGGGG - Intergenic
997246995 5:132358115-132358137 TCCCCTGGGGCTTAGCCCTGTGG + Intergenic
997998461 5:138605321-138605343 TGCCCTGGTGCTGAGTGGTGTGG - Intergenic
998092368 5:139378850-139378872 TGCCCTGGCACTTACTCCTGTGG + Intronic
998108350 5:139482449-139482471 TGAGCTGGGCCTGAGTCCTGGGG + Intronic
998524162 5:142827243-142827265 TGGCATGGCCCTGTGTCCTGTGG + Intronic
999144209 5:149381828-149381850 AGGCCTGGCACTGAGTCCTGGGG - Intronic
999314516 5:150575281-150575303 TGCCATGGAGGTGAGCCCTGCGG + Intergenic
999456750 5:151723267-151723289 TGCCCTGGTGCAGGGTTCTGAGG - Intergenic
1000509146 5:162160489-162160511 TGCCCTTCTGGTGAGTCCTGTGG + Intergenic
1002711178 5:181195791-181195813 GGCCTTGGCGCTGGGTGCTGGGG - Intronic
1002712396 5:181203479-181203501 AGCCCTGGTGCTGAGTTCTCAGG + Intronic
1003124970 6:3348845-3348867 TGCCCTGGCTCTGGGTCATGGGG - Intronic
1003540699 6:7015887-7015909 TGCCCTGGAGGTGTGTCCTCTGG - Intergenic
1004351380 6:14893179-14893201 TGCCCTGGCCCTGGGGGCTGAGG + Intergenic
1005198320 6:23314554-23314576 TGCCCTCACACTGAGACCTGAGG - Intergenic
1006625344 6:35393526-35393548 CCTCCTGGCTCTGAGTCCTGAGG + Intronic
1007728527 6:43931818-43931840 AACCCTGGCTCTGAGTTCTGAGG + Intergenic
1008026222 6:46638976-46638998 GACCCTGGGGCTCAGTCCTGAGG + Intronic
1010219928 6:73439907-73439929 TGCCCTGGTTCTGAATCCTGAGG - Intronic
1012244618 6:96912534-96912556 TCCCCTGGCGGTGAGACTTGGGG + Intergenic
1012325946 6:97917602-97917624 TGCCCTGGAGCTGAAAGCTGGGG + Intergenic
1013113668 6:107084198-107084220 TGCCCTAGTGCTGGTTCCTGTGG - Intronic
1014014410 6:116513601-116513623 GGACCTGGGGCTGATTCCTGTGG + Intronic
1016792332 6:148078986-148079008 TGCCCTGGGTCTGAGCACTGAGG - Intergenic
1018583106 6:165324886-165324908 TGGCCTGTGGCTCAGTCCTGGGG - Intergenic
1019316105 7:387663-387685 TTCCCTGGTCCTGAGCCCTGGGG + Intergenic
1019446001 7:1071690-1071712 TTCCCTGGCAATGCGTCCTGTGG - Intronic
1023737013 7:43244332-43244354 TGGCCTGGCTCTGAGTCAGGAGG - Intronic
1023863572 7:44228645-44228667 TGCCCTGGCGGGGCTTCCTGTGG - Intronic
1026081288 7:67223760-67223782 TGCCATGGGGCTGAGTCATCGGG + Intronic
1026695792 7:72590243-72590265 TGCCATGGGGCTGAGTCGTCAGG - Intronic
1029040249 7:97565796-97565818 TTCCTTGGCGCTGAGGCCTTTGG - Intergenic
1030013032 7:105189999-105190021 TGCTCTGGCACTGAGTACAGTGG + Intronic
1031511542 7:122656703-122656725 TTCCCTGGGGCAGAGTCCTTAGG + Intronic
1032069064 7:128792500-128792522 TGTCCTGGCTCAGAGGCCTGGGG - Intronic
1034047048 7:147940572-147940594 TGCCCTGGCTTTGAGTGCAGTGG + Intronic
1035088361 7:156281325-156281347 TGCCCTGCTGCTGTGTCCTCTGG + Intergenic
1040815936 8:51508596-51508618 GTGCCTGGGGCTGAGTCCTGAGG + Intronic
1042061569 8:64823881-64823903 TGTCCTGGTGCTTAGTCCTGGGG - Intergenic
1044598660 8:93982138-93982160 TGCCCAGGTGCTTAGTCCTTTGG + Intergenic
1046628746 8:116602811-116602833 TGTCCTAGCCCTGTGTCCTGCGG + Intergenic
1047526966 8:125641796-125641818 TGCCTTGGCCCAGATTCCTGGGG + Intergenic
1049390272 8:142364175-142364197 TGCACTGGCACTAAGGCCTGAGG + Intronic
1049686170 8:143940152-143940174 TGCCCTGGCCCTGGGGCCAGTGG + Intronic
1051094950 9:13455979-13456001 TTCCCTGGGGCATAGTCCTGGGG + Intergenic
1053512626 9:38701616-38701638 TATCCTGGTTCTGAGTCCTGTGG + Intergenic
1053761540 9:41352442-41352464 AGCCCTTGCGCTGTGCCCTGGGG - Intergenic
1054325465 9:63710290-63710312 AGCCCTTGCGCTGTGCCCTGGGG + Intergenic
1054350311 9:64013986-64014008 AGCCCTTGCGCTGAGCCCCGGGG - Intergenic
1054540134 9:66263559-66263581 AGCCCTTGCGCTGTGCCCTGGGG - Intergenic
1057028273 9:91753591-91753613 TTCCCTGGCCCTGAGACCTGTGG - Intronic
1059682212 9:116597181-116597203 TGCCCTGATCCTGAGTTCTGGGG - Intronic
1060516361 9:124268353-124268375 TGGCCTGGTGCTGGGTACTGGGG + Intronic
1060968528 9:127724808-127724830 GGCGCTGGCGCTGAGCCCTCAGG + Exonic
1061272799 9:129553098-129553120 GGCACTGGAGCTGAGACCTGAGG + Intergenic
1061476554 9:130871308-130871330 TGCCGTGGCACTGAGCCCTGGGG - Intronic
1061514471 9:131080762-131080784 GGGCCTGGCCCTGACTCCTGGGG - Intronic
1061666423 9:132163017-132163039 TGCCCCGGCGCTGCCGCCTGTGG - Intronic
1061929902 9:133827098-133827120 TGCTCTGGCCTGGAGTCCTGGGG - Intronic
1062213466 9:135376852-135376874 TGCCCTGGCCCTCCGCCCTGGGG - Intergenic
1202792001 9_KI270719v1_random:94573-94595 AGCCCTTGCGCTGTGCCCTGGGG + Intergenic
1186443677 X:9607593-9607615 GGCCCTGGCCCTGAGACCTGAGG + Intronic
1189398212 X:40642446-40642468 AGGCCTGGCCCTGAGTCCTGAGG + Intronic
1190074091 X:47302948-47302970 TGACATGGTGCTGAGCCCTGTGG + Intergenic
1192583361 X:72302411-72302433 TGCCATGGCTCTGAGCACTGAGG + Intronic
1196733368 X:118963364-118963386 TGACCTGGTGCAGAGCCCTGTGG - Intergenic
1197248914 X:124194256-124194278 GGCTCTGGGGCTGAGGCCTGTGG + Intronic
1197840518 X:130741309-130741331 TGCCCTTGAGCTGATTCCCGTGG - Intronic
1198446047 X:136715616-136715638 TGCCCTAGTGCTGGTTCCTGTGG - Intronic
1199010798 X:142756252-142756274 TTCTCTGGCTCTGAGGCCTGTGG + Intergenic
1199184079 X:144894366-144894388 TGCTCTGGTGATGAGTCCTTGGG - Intergenic