ID: 900130603

View in Genome Browser
Species Human (GRCh38)
Location 1:1085581-1085603
Sequence CGTGATGCCCTGAGGGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 164}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900130589_900130603 11 Left 900130589 1:1085547-1085569 CCGAGAGCCACCCAGCCCCGCTC 0: 1
1: 0
2: 3
3: 44
4: 400
Right 900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 164
900130591_900130603 1 Left 900130591 1:1085557-1085579 CCCAGCCCCGCTCCACTCGCCCC 0: 1
1: 1
2: 5
3: 49
4: 573
Right 900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 164
900130595_900130603 -6 Left 900130595 1:1085564-1085586 CCGCTCCACTCGCCCCTCGTGAT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 164
900130590_900130603 4 Left 900130590 1:1085554-1085576 CCACCCAGCCCCGCTCCACTCGC 0: 1
1: 0
2: 4
3: 88
4: 636
Right 900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 164
900130586_900130603 29 Left 900130586 1:1085529-1085551 CCCAGGCAAGTCCAACTGCCGAG 0: 1
1: 0
2: 1
3: 21
4: 155
Right 900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 164
900130588_900130603 18 Left 900130588 1:1085540-1085562 CCAACTGCCGAGAGCCACCCAGC 0: 1
1: 0
2: 1
3: 20
4: 164
Right 900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 164
900130587_900130603 28 Left 900130587 1:1085530-1085552 CCAGGCAAGTCCAACTGCCGAGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 164
900130592_900130603 0 Left 900130592 1:1085558-1085580 CCAGCCCCGCTCCACTCGCCCCT 0: 1
1: 0
2: 5
3: 46
4: 718
Right 900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 164
900130594_900130603 -5 Left 900130594 1:1085563-1085585 CCCGCTCCACTCGCCCCTCGTGA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 164
900130593_900130603 -4 Left 900130593 1:1085562-1085584 CCCCGCTCCACTCGCCCCTCGTG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900130603 Original CRISPR CGTGATGCCCTGAGGGCCCC GGG Intronic
900127191 1:1073852-1073874 TGTGAGGCCGTGAGTGCCCCAGG + Intronic
900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG + Intronic
904196664 1:28790754-28790776 CGTGATAACATGTGGGCCCCAGG + Intergenic
907966627 1:59337229-59337251 GGTGAAGGCCTGAGAGCCCCAGG + Intronic
908454973 1:64294778-64294800 TGTGAAGTCCTCAGGGCCCCAGG - Intergenic
911642958 1:100308299-100308321 GGTGAAGGCCTGAGAGCCCCTGG + Intergenic
913112755 1:115671162-115671184 CATGGTCTCCTGAGGGCCCCTGG + Intronic
914674656 1:149899506-149899528 CGTGGTGCCCTGAGGGCTCATGG - Exonic
918814678 1:189167768-189167790 CCTGAAGGCCTGAGAGCCCCTGG - Intergenic
922719689 1:227893847-227893869 AGTGGTGCCTTGAGGGCCTCGGG - Intergenic
924052367 1:240092059-240092081 CGGGATGGCCTGAGTGCCCGCGG + Exonic
924934501 1:248756663-248756685 GCTGATGGCCTGAGAGCCCCTGG + Intergenic
1065828694 10:29595350-29595372 CGTGCTGCTCTGAGGGTGCCGGG - Intronic
1066443962 10:35464732-35464754 GGTGAGGCCCTGTGGCCCCCAGG - Intronic
1067061598 10:43080649-43080671 TGGGATGTCCTGAGGGCACCTGG - Intronic
1067419729 10:46135010-46135032 TGTGATTCCCTCAGGGCTCCAGG + Intergenic
1067426289 10:46214401-46214423 TGTGATTCCCTCAGGGCTCCAGG - Intergenic
1067505080 10:46841607-46841629 TGTGATTCCCTCAGGGCTCCAGG + Intergenic
1070509340 10:77146342-77146364 CCTGATGCACTGAGAGACCCTGG + Intronic
1073181596 10:101586992-101587014 GGTCATTCCCTGAGGGCCCAGGG + Intronic
1074366457 10:112861319-112861341 CGTGAGGCCATGTAGGCCCCTGG - Intergenic
1075729130 10:124625870-124625892 CGTCAGGGCCTGAGGTCCCCGGG + Intronic
1076402693 10:130194205-130194227 CCTGCTGCCCTGCAGGCCCCTGG + Intergenic
1076703870 10:132290713-132290735 ATTGCTGCCCTGAGGGCCCAAGG + Intronic
1077338677 11:2016551-2016573 CGCCATGGCCAGAGGGCCCCAGG + Intergenic
1079792004 11:24749805-24749827 GCTGATGGCCTGAGAGCCCCTGG - Intronic
1080120154 11:28667721-28667743 AGAGATGCCCTGTGGACCCCAGG - Intergenic
1081057728 11:38431326-38431348 CCTGAAGGCCTGAGAGCCCCTGG - Intergenic
1082038752 11:47667400-47667422 GGAGATGTCCGGAGGGCCCCTGG + Intronic
1202821661 11_KI270721v1_random:71733-71755 CGCCATGGCCAGAGGGCCCCAGG + Intergenic
1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG + Exonic
1093457920 12:19382734-19382756 TGTGATGCCCTGAGCCTCCCTGG - Intergenic
1101916736 12:108901782-108901804 CGTGATGCCCTAAGCCTCCCTGG - Intergenic
1102101366 12:110281324-110281346 CGTGCGGCGCTGAGGGACCCGGG + Intronic
1102108689 12:110347908-110347930 CCTGATGCCCTGTGAGCACCGGG + Intronic
1106575535 13:30970983-30971005 GGTGCTGCCCTGAGGGAACCAGG - Intronic
1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG + Intergenic
1119651525 14:76387299-76387321 CCTGATGCCCTCACAGCCCCGGG + Intronic
1121108562 14:91296527-91296549 CGTGGGGCCCTCAGGGTCCCAGG + Intronic
1121137275 14:91510175-91510197 CGGGAGACTCTGAGGGCCCCCGG + Intronic
1122736796 14:103847886-103847908 CGTGATCCGCTGCGGGACCCGGG - Intergenic
1127426837 15:58865817-58865839 CGGGCTGGCCTGAGGGCCCCAGG + Intronic
1128942834 15:71802443-71802465 AGAGATGCCCACAGGGCCCCGGG + Intronic
1129234121 15:74213719-74213741 CCTGTTGCCCTGTGGGCCTCTGG + Intergenic
1129489414 15:75908893-75908915 CATGATGGCCTGTGGGGCCCAGG - Intronic
1129869565 15:78931879-78931901 GGTGATGCCATGAGGACCCTGGG - Intronic
1132797682 16:1733374-1733396 CGAGAGGTCCTGAGAGCCCCAGG + Intronic
1134023485 16:10937861-10937883 CTTGCTGCCCTGTGGTCCCCAGG - Intronic
1134063182 16:11211169-11211191 CCAGGTGCCCTGAGGGCTCCTGG + Intergenic
1134243808 16:12524932-12524954 CGTGATGCCCTGATCGCCATGGG + Intronic
1135044061 16:19140261-19140283 CGAAATGACCAGAGGGCCCCAGG + Intronic
1135066681 16:19316009-19316031 CATGATTGACTGAGGGCCCCAGG + Intronic
1136124640 16:28169091-28169113 CGTGAGGCCCTGAGGGTGCCGGG - Intronic
1136566496 16:31073622-31073644 CGGGAAGCCGCGAGGGCCCCGGG - Intronic
1137037094 16:35576605-35576627 CACCATGCCCCGAGGGCCCCAGG - Intergenic
1137686553 16:50390726-50390748 TGGGATGGCCTGCGGGCCCCCGG - Intergenic
1139322801 16:66129084-66129106 CCTGATCCCCTGGGGGACCCTGG + Intergenic
1142276250 16:89120380-89120402 CGCCTTGCCCTGATGGCCCCGGG - Intronic
1142358156 16:89613781-89613803 AGTGGTGCCCTGGGGTCCCCGGG - Intronic
1142873133 17:2834247-2834269 AGTTCTGCCCTGAGGGCCCCTGG + Intronic
1143594816 17:7907727-7907749 CCTGATGCCCTCTGGGACCCAGG - Intronic
1144834874 17:18151514-18151536 AGTGCTGACCTGAGGGCCTCAGG - Exonic
1145780447 17:27559660-27559682 CCAGATGCCCTGATGGCTCCGGG + Intronic
1147912012 17:43861565-43861587 CGGGGTGCCCTCAAGGCCCCAGG - Intronic
1148344919 17:46896857-46896879 CTAGATGCCCTCAGGGTCCCAGG - Intergenic
1148953865 17:51337390-51337412 GCTGAAGGCCTGAGGGCCCCGGG - Intergenic
1151434117 17:74083559-74083581 TGACATGCCCTGAGAGCCCCGGG + Intergenic
1152111045 17:78357955-78357977 AGAGAGGTCCTGAGGGCCCCAGG - Exonic
1152804796 17:82350512-82350534 CGAGATGCCCGGCTGGCCCCGGG + Intergenic
1152946260 17:83199119-83199141 CGGGATGCCCCGTGAGCCCCTGG + Intergenic
1158418702 18:57273495-57273517 TGTGATGCCATCTGGGCCCCTGG - Intergenic
1159589020 18:70311408-70311430 CGTGATGCTCTCAGGGCCAAAGG - Intronic
1160762377 19:791987-792009 CCTGTTGGCCTGAGGGCCCAGGG + Intergenic
1161018766 19:1997688-1997710 CGTGAGGCCCTGTGTGGCCCAGG - Intronic
1161128820 19:2576247-2576269 CGTGCAGCCCGGACGGCCCCAGG + Intronic
1161874628 19:6898462-6898484 GGTGATGCCCTCAGGTTCCCAGG + Intronic
1162026117 19:7895078-7895100 GGTGGTGCCCAGAGTGCCCCTGG + Intronic
1162496481 19:11025980-11026002 CCTGCTGCCCCGAGAGCCCCTGG + Intronic
1165309051 19:35019558-35019580 CCCGATGCCCTGGTGGCCCCAGG + Intronic
1165812108 19:38617923-38617945 CCTGAGGCCCTGCTGGCCCCTGG - Exonic
1167254570 19:48419477-48419499 CCAGATGCCTTGAGGGCCACTGG + Intronic
1167530552 19:50013339-50013361 CATGATGCCCTAAGGGACCCAGG - Intronic
929565003 2:42978671-42978693 CCTGATGCCCTGGGAGGCCCAGG - Intergenic
937159531 2:119746965-119746987 TGTGATGTCCTCAGGGACCCAGG - Intergenic
948626074 2:239268831-239268853 CCTGGTGCCCTAAGGTCCCCTGG - Intronic
1173555180 20:43960888-43960910 GGTGATGCCCTCTGAGCCCCTGG - Intronic
1174480401 20:50827374-50827396 CGTGATGCCATGTGGGCATCGGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175848540 20:62073287-62073309 GGTGAAGGCCTGAGAGCCCCTGG - Intergenic
1175975221 20:62707606-62707628 AGTAGTGCCCTGGGGGCCCCTGG + Intergenic
1176165688 20:63672284-63672306 CACGATGCCCTGGGAGCCCCCGG - Intronic
1176643140 21:9325124-9325146 CGGGATCCCCTGAGGCCCACGGG - Intergenic
1178994538 21:37386735-37386757 AGTGATGTCTTCAGGGCCCCAGG + Intronic
1179784623 21:43722373-43722395 GAGGCTGCCCTGAGGGCCCCAGG - Intronic
1180369796 22:11974092-11974114 CGGGATCCCCTGAGGCCCACGGG + Intergenic
1181487050 22:23238134-23238156 CGGGATGACCAGAGGGCCCAGGG - Intronic
1182298828 22:29326936-29326958 TGTGCTGCCCTGGGGACCCCAGG - Intergenic
1185170480 22:49290907-49290929 CGTGGTGCACTCAGGGGCCCTGG - Intergenic
1185216408 22:49602248-49602270 CGTGATGCCCTAAGCCGCCCTGG + Intronic
1185228531 22:49667617-49667639 CGTGCTGGGCTGGGGGCCCCAGG - Intergenic
1185228566 22:49667715-49667737 CGTGCTGAGCTGGGGGCCCCAGG - Intergenic
1185228601 22:49667813-49667835 CGTGCTGGGCTGGGGGCCCCAGG - Intergenic
1185228655 22:49667960-49667982 CGTGCTGAGCTGGGGGCCCCAGG - Intergenic
1185228689 22:49668058-49668080 CGTGCTGAGCTGGGGGCCCCAGG - Intergenic
949933863 3:9101534-9101556 TGTGATAACCAGAGGGCCCCTGG - Intronic
954155321 3:48682050-48682072 CGCGAGGCCCTGATGGCCTCTGG - Exonic
961001228 3:123375433-123375455 GGTGATGCCTTGAGGACCACTGG - Intronic
961216485 3:125164221-125164243 CGTGATTCCCTGGTGCCCCCTGG - Intronic
962283289 3:134067684-134067706 TGTGGGTCCCTGAGGGCCCCAGG - Intronic
966840841 3:184086017-184086039 TGTGAAGTCCTCAGGGCCCCAGG - Intergenic
967319410 3:188180404-188180426 CATGCTGCCCTGATGGCCCAAGG + Intronic
968044629 3:195617172-195617194 CGTCATTCCCTGAGGTCCACAGG + Intergenic
968060417 3:195723223-195723245 CGTCATTCCCTGAGGTCCACAGG + Intronic
1202743744 3_GL000221v1_random:79905-79927 CGGGATCCCCTGAGGCCCACGGG + Intergenic
968581792 4:1398739-1398761 TGTGGTGCCTGGAGGGCCCCTGG + Intergenic
968967663 4:3777253-3777275 CCTATTGCCCTGAGGTCCCCAGG + Intergenic
969453357 4:7287293-7287315 CGAGAGGCTCTGAGGCCCCCAGG + Intronic
977529717 4:98185659-98185681 CATGATGCCATGAGGGACTCAGG + Intergenic
978702487 4:111664851-111664873 CCTGATGCCCTGAGATCCCATGG - Intergenic
985662479 5:1164076-1164098 CCTGCGGCCCTGTGGGCCCCGGG + Intergenic
986284187 5:6347849-6347871 CGTGAGGGCCTGGGGGGCCCAGG + Intergenic
989103405 5:37840009-37840031 CGTGAAGACATGAGGGCGCCAGG + Intergenic
992614004 5:78532498-78532520 CATGATGTCATCAGGGCCCCAGG - Intronic
994043704 5:95285006-95285028 GGTGCTGCCCAGAGGGCGCCGGG - Intergenic
1001652787 5:173327670-173327692 CGGGAGGCCCAGAGGGTCCCCGG - Intronic
1002254545 5:177949657-177949679 CGTGAGGCCCTCAGTGCCCAGGG + Intergenic
1002338021 5:178493804-178493826 GCTGATGCACTGAGGACCCCTGG + Intronic
1002483446 5:179518155-179518177 CGTGAGGCCCTCAGTGCCCAGGG - Intergenic
1003414331 6:5894535-5894557 TGGCATGGCCTGAGGGCCCCTGG - Intergenic
1006297834 6:33177921-33177943 CGTGGTGCCCTGAGGGCTCTGGG - Intronic
1006298134 6:33179100-33179122 TGTGAGGCCCTGAGGTCCTCTGG + Exonic
1006425907 6:33962894-33962916 CGTGGAGCCTAGAGGGCCCCTGG - Intergenic
1007390832 6:41548639-41548661 CGCCATGCCCTGCGGGCACCGGG + Intronic
1008894992 6:56542719-56542741 CGTGCTGCCCTGAGGAGCCGCGG - Intronic
1013456479 6:110334174-110334196 CGGGGAGCCCTGTGGGCCCCCGG - Intronic
1015669438 6:135672110-135672132 GGGGATGCTCTGAGGGCCACTGG + Intergenic
1018867759 6:167759024-167759046 CCTGCTGCCCTGACAGCCCCAGG + Intergenic
1019102304 6:169641261-169641283 CGTGAAGCGCTGCGGGCCGCAGG + Intronic
1019288368 7:234906-234928 GGTGCTGGCCTGAGGGCTCCTGG - Intronic
1019443747 7:1060394-1060416 GGAGCTGCCCTGAGCGCCCCGGG + Intronic
1022316821 7:29253205-29253227 CCTGATGCCATCAGGGACCCAGG + Intronic
1024609607 7:51053372-51053394 TGTGCTGCCCTCAGGGACCCAGG + Intronic
1027855791 7:83509340-83509362 AGTGTTGCCCTGAAGGGCCCTGG + Intronic
1029381905 7:100220405-100220427 CGTCCTTCCCTGAGGGCTCCTGG + Exonic
1029402069 7:100352855-100352877 CGTCCTTCCCTGAGGGCTCCTGG + Exonic
1029460702 7:100692722-100692744 CGTGGGACCCTCAGGGCCCCTGG + Intergenic
1029561115 7:101303384-101303406 CGGACTGTCCTGAGGGCCCCGGG - Intergenic
1030704205 7:112674535-112674557 TGTGATGCCCTGAGCACCCTCGG - Intergenic
1032196959 7:129795035-129795057 AGCACTGCCCTGAGGGCCCCAGG + Intergenic
1032482121 7:132255681-132255703 GGTGATGCCCTGTGATCCCCAGG + Intronic
1034535926 7:151725750-151725772 TGTGCAGCCCTGGGGGCCCCGGG - Intronic
1036821337 8:11942459-11942481 CTTGCTGGCCTCAGGGCCCCAGG - Intergenic
1041262837 8:56036657-56036679 CGTCATGGCCTGAGGGTGCCTGG - Intergenic
1047251677 8:123185669-123185691 GGTGAACCCCTGAGGGTCCCAGG - Intronic
1048439288 8:134448041-134448063 CATGATGCCCAGAGGGTCTCTGG - Intergenic
1049166145 8:141127821-141127843 CCTGATGCCCGGTGGGCCACGGG - Intronic
1049534182 8:143170454-143170476 CGTGGAGCACTGGGGGCCCCTGG - Intergenic
1049685758 8:143938736-143938758 GGTGGTCACCTGAGGGCCCCCGG - Intronic
1049696798 8:143987993-143988015 CCTGATGCTCAGAGGGCTCCAGG + Intronic
1049800468 8:144515329-144515351 CCAACTGCCCTGAGGGCCCCAGG + Exonic
1049959145 9:721683-721705 CCTGAAGCCTTGAGGGACCCAGG - Intronic
1050880010 9:10687946-10687968 CATGATGCCCTGAGCTCTCCCGG - Intergenic
1055645203 9:78356517-78356539 CCTGATGAACTGAGGTCCCCAGG - Intergenic
1061054214 9:128213826-128213848 CTTGATGTTCTGATGGCCCCGGG - Intronic
1062102280 9:134734508-134734530 CGGGACGCCCGCAGGGCCCCAGG - Intronic
1062110929 9:134781782-134781804 CTTGAGGCCCTGGGAGCCCCGGG + Intronic
1062191245 9:135248976-135248998 CATGCTACCCTGAGGGCCTCGGG + Intergenic
1062400821 9:136371869-136371891 AGTGTTGCCCCGCGGGCCCCAGG - Intronic
1203712378 Un_KI270742v1:109869-109891 CGGGATCCCCTGAGGCCCACGGG + Intergenic
1187948732 X:24451559-24451581 CCTCATGCCCTGAGGGACCGAGG + Intergenic
1195000250 X:100636569-100636591 CGGGATCCCCTGCCGGCCCCAGG + Intronic
1197153474 X:123245285-123245307 CGTGATGCCTTGAGGGCCTCTGG + Intronic