ID: 900131002

View in Genome Browser
Species Human (GRCh38)
Location 1:1087247-1087269
Sequence GGTGCACGTGGGTGTCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 116}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900131002_900131015 22 Left 900131002 1:1087247-1087269 CCACGGGGACACCCACGTGCACC 0: 1
1: 0
2: 1
3: 24
4: 116
Right 900131015 1:1087292-1087314 ATATGAAAGCGAGGGGCTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 102
900131002_900131016 23 Left 900131002 1:1087247-1087269 CCACGGGGACACCCACGTGCACC 0: 1
1: 0
2: 1
3: 24
4: 116
Right 900131016 1:1087293-1087315 TATGAAAGCGAGGGGCTGAGGGG 0: 1
1: 1
2: 0
3: 6
4: 170
900131002_900131018 27 Left 900131002 1:1087247-1087269 CCACGGGGACACCCACGTGCACC 0: 1
1: 0
2: 1
3: 24
4: 116
Right 900131018 1:1087297-1087319 AAAGCGAGGGGCTGAGGGGGCGG 0: 1
1: 0
2: 1
3: 57
4: 571
900131002_900131011 13 Left 900131002 1:1087247-1087269 CCACGGGGACACCCACGTGCACC 0: 1
1: 0
2: 1
3: 24
4: 116
Right 900131011 1:1087283-1087305 AGGACGGAAATATGAAAGCGAGG 0: 1
1: 0
2: 0
3: 12
4: 169
900131002_900131017 24 Left 900131002 1:1087247-1087269 CCACGGGGACACCCACGTGCACC 0: 1
1: 0
2: 1
3: 24
4: 116
Right 900131017 1:1087294-1087316 ATGAAAGCGAGGGGCTGAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 292
900131002_900131012 14 Left 900131002 1:1087247-1087269 CCACGGGGACACCCACGTGCACC 0: 1
1: 0
2: 1
3: 24
4: 116
Right 900131012 1:1087284-1087306 GGACGGAAATATGAAAGCGAGGG 0: 1
1: 0
2: 0
3: 4
4: 168
900131002_900131013 15 Left 900131002 1:1087247-1087269 CCACGGGGACACCCACGTGCACC 0: 1
1: 0
2: 1
3: 24
4: 116
Right 900131013 1:1087285-1087307 GACGGAAATATGAAAGCGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 84
900131002_900131007 -7 Left 900131002 1:1087247-1087269 CCACGGGGACACCCACGTGCACC 0: 1
1: 0
2: 1
3: 24
4: 116
Right 900131007 1:1087263-1087285 GTGCACCCTGAAGGGATCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 125
900131002_900131008 -3 Left 900131002 1:1087247-1087269 CCACGGGGACACCCACGTGCACC 0: 1
1: 0
2: 1
3: 24
4: 116
Right 900131008 1:1087267-1087289 ACCCTGAAGGGATCTCAGGACGG 0: 1
1: 0
2: 8
3: 33
4: 213
900131002_900131014 21 Left 900131002 1:1087247-1087269 CCACGGGGACACCCACGTGCACC 0: 1
1: 0
2: 1
3: 24
4: 116
Right 900131014 1:1087291-1087313 AATATGAAAGCGAGGGGCTGAGG 0: 1
1: 0
2: 2
3: 10
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900131002 Original CRISPR GGTGCACGTGGGTGTCCCCG TGG (reversed) Intronic