ID: 900131765

View in Genome Browser
Species Human (GRCh38)
Location 1:1090237-1090259
Sequence CTCATCTGTGCTGCGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 115}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900131765_900131775 10 Left 900131765 1:1090237-1090259 CCAGGTCCCGCAGCACAGATGAG 0: 1
1: 0
2: 1
3: 7
4: 115
Right 900131775 1:1090270-1090292 GTCACCGAGGGGAGGGCCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 162
900131765_900131779 27 Left 900131765 1:1090237-1090259 CCAGGTCCCGCAGCACAGATGAG 0: 1
1: 0
2: 1
3: 7
4: 115
Right 900131779 1:1090287-1090309 CCTGGGCACACACACACCAGTGG 0: 1
1: 0
2: 3
3: 32
4: 376
900131765_900131774 9 Left 900131765 1:1090237-1090259 CCAGGTCCCGCAGCACAGATGAG 0: 1
1: 0
2: 1
3: 7
4: 115
Right 900131774 1:1090269-1090291 TGTCACCGAGGGGAGGGCCCTGG 0: 1
1: 0
2: 1
3: 25
4: 206
900131765_900131772 3 Left 900131765 1:1090237-1090259 CCAGGTCCCGCAGCACAGATGAG 0: 1
1: 0
2: 1
3: 7
4: 115
Right 900131772 1:1090263-1090285 TGTCCTTGTCACCGAGGGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 106
900131765_900131770 -1 Left 900131765 1:1090237-1090259 CCAGGTCCCGCAGCACAGATGAG 0: 1
1: 0
2: 1
3: 7
4: 115
Right 900131770 1:1090259-1090281 GCACTGTCCTTGTCACCGAGGGG 0: 1
1: 0
2: 2
3: 9
4: 93
900131765_900131771 2 Left 900131765 1:1090237-1090259 CCAGGTCCCGCAGCACAGATGAG 0: 1
1: 0
2: 1
3: 7
4: 115
Right 900131771 1:1090262-1090284 CTGTCCTTGTCACCGAGGGGAGG 0: 1
1: 1
2: 0
3: 8
4: 96
900131765_900131769 -2 Left 900131765 1:1090237-1090259 CCAGGTCCCGCAGCACAGATGAG 0: 1
1: 0
2: 1
3: 7
4: 115
Right 900131769 1:1090258-1090280 AGCACTGTCCTTGTCACCGAGGG 0: 1
1: 0
2: 0
3: 16
4: 98
900131765_900131768 -3 Left 900131765 1:1090237-1090259 CCAGGTCCCGCAGCACAGATGAG 0: 1
1: 0
2: 1
3: 7
4: 115
Right 900131768 1:1090257-1090279 GAGCACTGTCCTTGTCACCGAGG 0: 1
1: 0
2: 0
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900131765 Original CRISPR CTCATCTGTGCTGCGGGACC TGG (reversed) Intronic
900131765 1:1090237-1090259 CTCATCTGTGCTGCGGGACCTGG - Intronic
901828666 1:11879069-11879091 CTCCTCTGTGCTGGTGGGCCTGG + Intergenic
902703673 1:18190142-18190164 CCCATCTGTGCTGCTGGATGAGG + Intronic
904381504 1:30114209-30114231 TGCATCTGTGCTGCGGGTCATGG - Intergenic
913453389 1:119007713-119007735 CTGTTCTGTGGAGCGGGACCTGG + Intergenic
915118634 1:153615264-153615286 CCCTTCTGAGCTACGGGACCTGG - Exonic
915589181 1:156860971-156860993 CACAGCTGGGCTGCGGGGCCGGG + Exonic
916169838 1:161993664-161993686 CCCATCTGTGCTGGCGTACCTGG + Intronic
917771346 1:178282832-178282854 CTCATTTGGGCTGCTGGAACTGG - Intronic
923551003 1:234963305-234963327 CTCATCTGTGCTGAAAGCCCCGG + Intergenic
1064199482 10:13272481-13272503 CTCAACTGTGCCGCTGGAGCAGG - Intergenic
1070498512 10:77047922-77047944 CCCATCTGAGGTGAGGGACCAGG + Intronic
1070740541 10:78900388-78900410 CCCAGCTGTGCTGTGGGCCCAGG - Intergenic
1073487134 10:103826645-103826667 CTAAAATGTGCTCCGGGACCTGG - Intronic
1075575361 10:123573507-123573529 CTCAGCTGTGCTGGGGCGCCCGG + Intergenic
1075979189 10:126722435-126722457 TTCAGCTGTCCTGCAGGACCTGG + Intergenic
1076536806 10:131183699-131183721 CTCATCTGAGCTCAGGGCCCAGG + Intronic
1082723292 11:56705462-56705484 CTCATCTGTTCAGCAGGAGCAGG + Intergenic
1085757794 11:79216031-79216053 CTCTTCATTGCTGTGGGACCAGG - Intronic
1096195747 12:49647852-49647874 CTCATCCGTGGTGTGGGAGCTGG - Intronic
1102772607 12:115491574-115491596 CGCAACTGAGCTGCAGGACCTGG - Intergenic
1105247520 13:18666547-18666569 CTCCTACGTGCTGCAGGACCCGG + Intergenic
1107468305 13:40667836-40667858 CTCATCTGGGCTGCAGGTCCAGG + Intergenic
1108518300 13:51222649-51222671 CTGATCCGTGCGACGGGACCGGG + Intronic
1113895548 13:113761842-113761864 CTCATCTGAGCCCCGGGAACCGG + Intronic
1119811228 14:77521383-77521405 CTTATCTGTGATGTGAGACCAGG - Intronic
1122152898 14:99734313-99734335 CCCAAGTGGGCTGCGGGACCAGG - Intergenic
1124420480 15:29516826-29516848 CTCCTCTGTGCTGCCCGCCCAGG - Intronic
1125585309 15:40815410-40815432 CATATCTGTGCTGAGGGACAGGG - Intergenic
1126171700 15:45700700-45700722 ATGATCTGTGCTGAAGGACCAGG - Intergenic
1128550359 15:68594423-68594445 CTCACCTGGGCTGGGGAACCTGG - Intronic
1129753263 15:78080617-78080639 CTCATCTGTGCTGGGTGACCAGG - Intronic
1132605037 16:790092-790114 CCCATCAGTGCTCAGGGACCCGG - Intronic
1133596015 16:7293578-7293600 CTCATCTGGCCTGCGAGTCCAGG - Intronic
1134641089 16:15829772-15829794 CTCATTTCTGCTGCAGGCCCCGG - Intronic
1135898532 16:26433087-26433109 CTCATCTGTCCTGCAGGTCCAGG - Intergenic
1138814944 16:60193338-60193360 ATCATCTGTTCTTCTGGACCAGG + Intergenic
1139549161 16:67663932-67663954 CTCACCTTAGCTTCGGGACCTGG + Exonic
1141426829 16:83949657-83949679 CTCAGGTGTGCTGTGTGACCTGG - Intronic
1144075988 17:11719592-11719614 CTGATCTGGGCTCCGAGACCTGG - Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1145976931 17:28989140-28989162 GTGATTTGTGCTGAGGGACCTGG - Intronic
1147141605 17:38463549-38463571 CTGCTCTGTGCTGGGGGAGCGGG + Intronic
1147250501 17:39150466-39150488 ATCATCTCTGCTGAGGGGCCAGG + Intronic
1148085056 17:44988761-44988783 CTCAGCTGTGCTGCAGAACGCGG + Intergenic
1149003048 17:51776843-51776865 CTCATCTGTGTAGCGGGGCGTGG + Intronic
1152210590 17:79001092-79001114 CACATCTGAGCTGCAGGCCCGGG + Intronic
1153835308 18:8958863-8958885 CTCATCTGTTCTTTGGGAGCTGG - Intergenic
1154441318 18:14392574-14392596 CTCCTACGTGCTGCAGGACCGGG - Intergenic
1155071131 18:22317241-22317263 CTCAGCTGTGCTGGGACACCCGG + Intergenic
1155310076 18:24514841-24514863 CTCAACTGTGCTGCTGGAGCAGG - Intergenic
1156321507 18:36029418-36029440 CCCATGTCTGCTTCGGGACCAGG + Intronic
1158531915 18:58270377-58270399 CTCTCCTGTGCTGGGGGAGCTGG - Intronic
1159948721 18:74463124-74463146 CTCATGTGTACTCCGGGAGCTGG - Intergenic
1160874028 19:1288958-1288980 CTCACCTGTCCTGTTGGACCTGG + Intronic
1165258386 19:34593669-34593691 CTCCTCTGAGCTCGGGGACCGGG - Intronic
1166567177 19:43772328-43772350 CTCCTCTCTGCTGTGTGACCTGG + Intronic
925852482 2:8096155-8096177 CTCATCTGTGAGACGGGAACAGG - Intergenic
926173663 2:10570022-10570044 CCCATTTGTGCTGTGGTACCAGG - Intergenic
927718693 2:25369307-25369329 CACAGCTGGGCTCCGGGACCTGG + Intergenic
933354741 2:81197072-81197094 GTCATCGGTGCTGCAGGACGGGG + Intergenic
938727687 2:134121500-134121522 CTCCTCAGGGCTGCGGGAACCGG + Intronic
943821310 2:192326159-192326181 CTCATCTGTGCTACCCTACCAGG - Intergenic
947832010 2:233148184-233148206 CTCATCTGCCCTGCTGGCCCTGG - Intronic
948900982 2:240956805-240956827 CCCATCTGTGATGGGGCACCAGG + Intronic
1169204857 20:3733698-3733720 CTGATCTGTGCTTTGGGCCCTGG + Intronic
1171338931 20:24412051-24412073 CTCATCTGGGCTTCAGGATCTGG + Intergenic
1174220306 20:48949104-48949126 CTCATCTGTGCAGTGAGACAAGG - Intronic
1174450413 20:50616702-50616724 CTCTTCTCTGCTGTGTGACCGGG - Intronic
1175919618 20:62444614-62444636 CTCATCTGTGCAGCGGGGAAGGG + Intergenic
1176454737 21:6898600-6898622 CTCCTACGTGCTGCAGGACCCGG + Intergenic
1176832909 21:13763648-13763670 CTCCTACGTGCTGCAGGACCCGG + Intergenic
1178156335 21:29858360-29858382 CTCATCTCTTCTGCAGTACCAGG + Intronic
1180253339 21:46605055-46605077 GTCGTCTCTGCTGCGGGTCCTGG + Exonic
1183366491 22:37409760-37409782 CTCAGGGGTGCGGCGGGACCTGG - Intronic
1183398171 22:37585255-37585277 CTCATCAGAGCTGCAGGAGCAGG - Intergenic
1184239875 22:43206450-43206472 CTCCTCTGTGCTGTGGGGGCAGG + Intronic
1185195874 22:49469326-49469348 TTCATCTGAGATGTGGGACCAGG + Intronic
950425466 3:12922769-12922791 CTCATCTGTGGGGCAGGGCCTGG + Intronic
951383773 3:22019755-22019777 TTAATCTATGCTGCGGGAACTGG + Intronic
953485872 3:43295122-43295144 TTCATCTGTGTTGCTGGTCCAGG + Intronic
953651467 3:44809070-44809092 TGCATCTATGCTGCGGGAACAGG - Intronic
954278095 3:49555138-49555160 CTCTCCTGTGCGGAGGGACCAGG - Intronic
954868306 3:53748282-53748304 CTCATCTATGCATGGGGACCGGG - Intronic
958549638 3:95595675-95595697 GCCAGCTGTGCTGGGGGACCCGG + Intergenic
959358945 3:105366690-105366712 CTCATCCGGGCTCCAGGACCGGG + Intergenic
968575597 4:1364678-1364700 CTCAGCTGTGCTGTGGGAACAGG + Intronic
968588677 4:1446818-1446840 CTGCTCTGTGCTGGGGGAGCCGG - Intergenic
969363535 4:6680761-6680783 CCCATCTGTCCTGCTGCACCAGG - Intergenic
969671941 4:8594472-8594494 CTCAACTCTGCTGTGTGACCTGG + Intronic
972148888 4:36064564-36064586 CCCACCTGAGCTGCAGGACCAGG - Intronic
972162611 4:36244594-36244616 CCCAACTATGCTGCGGAACCAGG - Intergenic
974580958 4:63800694-63800716 CTTCTCTATGGTGCGGGACCAGG - Intergenic
980678930 4:136129371-136129393 CTCATCTGTGTTGCTGGTACTGG + Intergenic
982309068 4:153964943-153964965 CTCATGAGTCCTGGGGGACCTGG + Intergenic
983843172 4:172482066-172482088 CCCAGCAGTGCTGGGGGACCCGG + Intronic
989106889 5:37871302-37871324 CACATCTGTGTTGCAGAACCAGG - Intergenic
989558191 5:42820954-42820976 CTCTTCTGTGCTGGGCAACCTGG + Intronic
991487270 5:67150559-67150581 CCCATCTGTGCAGCTGCACCAGG - Intronic
992431692 5:76716378-76716400 CTCACCTGGCCTGCGGGCCCGGG - Exonic
1004198106 6:13523933-13523955 CTCATCTGGGCTGCAGGAAAAGG + Intergenic
1006034055 6:31198170-31198192 CGCCTCTGTGCTGTGGGTCCAGG + Intronic
1006870505 6:37246948-37246970 CTGATAGGTACTGCGGGACCCGG - Intronic
1007094547 6:39205269-39205291 CACAGCAGTGCTGTGGGACCAGG - Intronic
1007112049 6:39318515-39318537 CTCATGTGTTCTGAGGGAACAGG - Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1018846189 6:167558316-167558338 CTCATCTGTGCTGGAGAAACGGG + Intergenic
1019401528 7:856822-856844 CTCATCTCTGCTGCTGCTCCTGG + Intronic
1019590502 7:1828037-1828059 CTCTTATGTGCTGTGGGCCCCGG + Intronic
1032357399 7:131223507-131223529 CTGACTTGTGTTGCGGGACCAGG + Intronic
1032476094 7:132212369-132212391 CTCATGTTTGCTCTGGGACCTGG - Intronic
1032985159 7:137329519-137329541 CTCATCAGTGCTCAGGTACCTGG - Intronic
1035102711 7:156414726-156414748 GGCCTCTGTGCTGGGGGACCTGG + Intergenic
1039969855 8:42312376-42312398 CTCATCAGTGCTGGAGGACCAGG + Intronic
1043391805 8:79799002-79799024 CTCACCTTTGCTCTGGGACCTGG - Intergenic
1049039685 8:140103080-140103102 CTCGTCTGTGCTGTGGGAGTGGG - Intronic
1056899312 9:90583608-90583630 CTCAGCTGTGCTGTAGGGCCGGG + Intergenic
1057704103 9:97385757-97385779 CTCATCTGGGCTGGAGGAGCCGG + Intergenic
1060149617 9:121279923-121279945 CTTATCTGGGCTGCAGGACCTGG - Intronic
1060996261 9:127876276-127876298 CTCTTCTGTGCTGCGGGCCTGGG + Intronic
1061729725 9:132604428-132604450 ATCATCTGTGCAGCTGGCCCAGG + Intronic
1202799487 9_KI270719v1_random:162847-162869 CTGAGCTGTGCTGAGGGACAAGG + Intergenic
1195954969 X:110318531-110318553 CTGAGCTGTGCTTTGGGACCTGG - Intronic
1198052025 X:132959261-132959283 CTCTTTTCTGCTGCTGGACCAGG + Intronic