ID: 900131819

View in Genome Browser
Species Human (GRCh38)
Location 1:1090483-1090505
Sequence CCCTCAGCCGCTGCTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 475}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900131819_900131826 14 Left 900131819 1:1090483-1090505 CCCAGAGCAGCAGCGGCTGAGGG 0: 1
1: 0
2: 4
3: 49
4: 475
Right 900131826 1:1090520-1090542 CATCTCAATGTCCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 9
4: 108
900131819_900131827 24 Left 900131819 1:1090483-1090505 CCCAGAGCAGCAGCGGCTGAGGG 0: 1
1: 0
2: 4
3: 49
4: 475
Right 900131827 1:1090530-1090552 TCCGCAGCTCCGGCCTCTTCTGG 0: 1
1: 0
2: 0
3: 16
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900131819 Original CRISPR CCCTCAGCCGCTGCTGCTCT GGG (reversed) Intronic