ID: 900135284

View in Genome Browser
Species Human (GRCh38)
Location 1:1114602-1114624
Sequence CTGGGGGCGGGATGTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900135277_900135284 1 Left 900135277 1:1114578-1114600 CCTGACTGGCTTTTAGGAGGAGT 0: 1
1: 0
2: 2
3: 13
4: 125
Right 900135284 1:1114602-1114624 CTGGGGGCGGGATGTGTGTCAGG 0: 1
1: 0
2: 0
3: 27
4: 248
900135275_900135284 5 Left 900135275 1:1114574-1114596 CCTGCCTGACTGGCTTTTAGGAG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 900135284 1:1114602-1114624 CTGGGGGCGGGATGTGTGTCAGG 0: 1
1: 0
2: 0
3: 27
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900135284 Original CRISPR CTGGGGGCGGGATGTGTGTC AGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900135284 1:1114602-1114624 CTGGGGGCGGGATGTGTGTCAGG + Intronic
900191983 1:1355840-1355862 GTGGGGGAGGGATGTCTGTAAGG + Intronic
900398451 1:2462841-2462863 CTGGTGCCAAGATGTGTGTCGGG + Intronic
901036496 1:6339100-6339122 CTGGGCGCGGGCTGTGAGGCCGG - Intronic
901301412 1:8202297-8202319 CAGGAGGCGGGATGTGCGCCTGG + Intergenic
901767807 1:11515088-11515110 CTGGGGGTAGGAACTGTGTCTGG - Intronic
903500696 1:23798792-23798814 CCGGGCGGGGAATGTGTGTCTGG - Intronic
903657855 1:24959872-24959894 CTGGGAGCGTGGTGTGGGTCTGG - Intronic
903969076 1:27107404-27107426 AGGGGGGCTGGATGTGTGTATGG - Intronic
904744696 1:32703284-32703306 CTGGGGGCGGGCTGGGTGGCTGG + Intronic
904773435 1:32893501-32893523 CTGGGGGCGGGAGGGGAGGCGGG - Intronic
905150061 1:35920280-35920302 CTAGGGGCTGGATGTCTGTCAGG - Exonic
906479313 1:46189793-46189815 CTTGGGGCAGTATGTGTGTGAGG + Intronic
907332807 1:53682290-53682312 CTGGTGGCAGGTTGTGTGTTAGG + Intronic
907547422 1:55274411-55274433 GTGGGGGTGGGCTGTGTGTGTGG + Intergenic
907802851 1:57789121-57789143 CTGGGGGCAGGTTGTGGTTCAGG - Intronic
908946758 1:69507788-69507810 GTGGGGGCAGGATGGGTGGCAGG + Intergenic
911668180 1:100578408-100578430 CTGGGGGCGAGTGATGTGTCAGG - Intergenic
914250610 1:145918721-145918743 CTAGGGGCGGGAAGTGGGGCGGG - Exonic
914902246 1:151716951-151716973 CTGGGGGCGGGAAGGGAGTCAGG - Intronic
915418426 1:155760321-155760343 CTAGGGGATGGCTGTGTGTCTGG + Intronic
917009435 1:170454452-170454474 CTTGGGAGGGTATGTGTGTCCGG + Intergenic
917968888 1:180194941-180194963 CAGGAGGCGGTTTGTGTGTCGGG + Intronic
918332602 1:183473422-183473444 GTGTGTGCGAGATGTGTGTCTGG + Intronic
919972566 1:202590572-202590594 CTGGGGGTGGGGGGTGTCTCTGG - Exonic
920021317 1:202958413-202958435 CCCGGGGCGGGAGGTGTGGCCGG - Intronic
920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG + Intronic
920545171 1:206810451-206810473 CTGGGGGATGGATGTGAGGCTGG - Intronic
922770951 1:228182672-228182694 GTGGGGACGGGGTGTGTGTGGGG + Intergenic
922856899 1:228783232-228783254 ATGGGGAGGGGATGTGTGTGAGG + Intergenic
1062831509 10:608564-608586 TGGGGGGGGGGATGTGTGTGTGG - Intronic
1063379838 10:5577446-5577468 GTGGGTGCGGGGTGTGTGTGCGG - Intergenic
1063588965 10:7377959-7377981 GTGGGGGGGGGTTGTGTGTGTGG + Intronic
1064024712 10:11838186-11838208 CTGGGGGGTGAGTGTGTGTCGGG - Intronic
1065963841 10:30754945-30754967 CTGGGGGTGGGCTGTGGGGCTGG - Intergenic
1067406522 10:46028942-46028964 CCGGGGGAGGGATATGTGTCAGG + Intronic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1067826109 10:49574175-49574197 CTGGGGCCGAGATGTGAGTCAGG + Intergenic
1069076584 10:64043619-64043641 CAGGTGGCGGGATGTGTTCCTGG + Intergenic
1073779337 10:106820202-106820224 CTTGGGGCAGTATGTGTGTTTGG - Intronic
1074503154 10:114044095-114044117 CCGGGGGCGGGGGGTGTGGCAGG - Exonic
1076059254 10:127400772-127400794 CTGGGGGTGGGAGGTGGGTGAGG - Intronic
1081777326 11:45684577-45684599 CTGGGAGTGGGATGTGGTTCTGG - Intergenic
1083196369 11:61091078-61091100 CAGGCTGCGGGATGTGTGACTGG + Intergenic
1083844676 11:65324195-65324217 CTGGGGGAGTGGTGGGTGTCTGG - Intergenic
1083997269 11:66278561-66278583 CTGGGGGCGGGGTGGGGGGCAGG + Intronic
1084421383 11:69062407-69062429 CTGGAGGCAGGGTCTGTGTCTGG + Intronic
1085672224 11:78477928-78477950 TTGAGGGCGGGGTGTGTGTGTGG - Intronic
1085689246 11:78652088-78652110 GTGGGGGAGGGAGGTGTGACGGG + Intergenic
1085733413 11:79018472-79018494 GTGGGGTAGGGATGTGTGTGGGG - Intronic
1087261512 11:96017601-96017623 CTGGAGGCGGGGTGTGTTGCTGG + Intronic
1088878094 11:113952382-113952404 CTGTGGGCGGCCTCTGTGTCAGG + Intergenic
1090434838 11:126677952-126677974 CTGGGGACGGGGTGTGTCTCTGG - Intronic
1091479362 12:810867-810889 CTGGGGGTGGGGTGGGGGTCAGG - Intronic
1092282585 12:7108991-7109013 GGGGGGGGGGGATGTGTGTGTGG + Intronic
1096396475 12:51270083-51270105 CTGGGGGCGGCCGGTGCGTCGGG + Intronic
1097224564 12:57469706-57469728 CTGGGTGTGGGAGGTGTGGCTGG + Intronic
1099954953 12:89344696-89344718 CTGGGAGAGGGAGGTGGGTCAGG - Intergenic
1100730491 12:97462220-97462242 CTGGGGGTGGGAGGTGTTTTGGG + Intergenic
1101966648 12:109286745-109286767 CTGGGGGCAGGAGGTGGGGCAGG + Intronic
1101970527 12:109309395-109309417 CTGGGGGGGGGGTGTGTGTGAGG + Intergenic
1102864268 12:116361571-116361593 CTGGGGGTGGGAGGTGGGACAGG - Intergenic
1102954841 12:117052751-117052773 CTGGGGGTGGGTTGGGTGTGGGG - Intronic
1103269997 12:119665355-119665377 TTGGGGGCTGGAGGTGTGCCAGG - Intergenic
1103336690 12:120194992-120195014 CTGCGGGCTGGAAGTGGGTCAGG - Intergenic
1103698405 12:122835204-122835226 CGGGGGGCGGGGCGTGTGCCGGG + Intronic
1104607894 12:130203250-130203272 CTTGGGGCGGAAAGTGTGCCTGG - Intergenic
1105004256 12:132711090-132711112 CCGGGGTCGGGATGGGGGTCAGG + Intronic
1105459003 13:20566835-20566857 CTGGGGGCGGCCTGTGTGAAGGG - Intergenic
1105611748 13:21974851-21974873 CTGGGGGCTGGATCTGTGAATGG + Intergenic
1106411893 13:29516400-29516422 TTGGGTGCGGGCTGTGTGTGGGG - Intronic
1106675129 13:31950345-31950367 CTGTGGGCATGATGTGTGTCAGG - Intergenic
1108486323 13:50930035-50930057 CTGGGGGGTGTATGTGTGTATGG - Intronic
1109254411 13:60061610-60061632 GTGGGGGTGGGAGGTGTGTGTGG - Intronic
1112299118 13:98214044-98214066 CTGGGGGCCGGAGGTGTCACAGG + Intronic
1112680801 13:101762951-101762973 CTGGAGGCAGGGTGTGTGTTTGG - Intronic
1113263523 13:108592335-108592357 CTGTGTGTGGGATGTGTGTGTGG + Intergenic
1113474753 13:110572361-110572383 CTTGGGAGGGGATGTGTCTCAGG - Intergenic
1113670118 13:112170675-112170697 CTGGGGGAGGGAGGGGTGTGGGG - Intergenic
1113680449 13:112240073-112240095 GTGGGGACTGGGTGTGTGTCCGG - Intergenic
1113785162 13:112998610-112998632 CTGGGGAACGGCTGTGTGTCTGG + Intronic
1114191182 14:20440501-20440523 CTAGGGGTGGTATGTGTGTGGGG + Intergenic
1115968151 14:38915343-38915365 CTTGGGAGGGTATGTGTGTCCGG - Intergenic
1116472722 14:45305135-45305157 CTGGGGAGAGGATGTGGGTCAGG + Intergenic
1118251109 14:64162237-64162259 CTGGGGGCAGGATCTCTGCCAGG - Exonic
1119667639 14:76496647-76496669 CTGGAGGAGGGATGGGTGCCAGG + Intronic
1120587226 14:86328089-86328111 CTTTGGGCTTGATGTGTGTCCGG + Intergenic
1120750693 14:88195209-88195231 GTGGGGTTGGGATGTGTCTCAGG - Intronic
1121116413 14:91346267-91346289 TGGGGGGCGGGGTGTGTTTCTGG - Intronic
1121324936 14:93014353-93014375 CTGTGGGCTGTGTGTGTGTCTGG + Intronic
1121328233 14:93034165-93034187 CTGGGGGCAGGATGTGGGGGAGG - Intronic
1121331711 14:93053716-93053738 AGGGGGGCTGCATGTGTGTCAGG + Intronic
1122209923 14:100167370-100167392 GGGGGGGCGGGGTGTGTGTTGGG - Intergenic
1122323172 14:100867591-100867613 CTGGGGGCAGGATGTGGATGTGG - Intergenic
1122541409 14:102499683-102499705 GAGGGGGCGGGATGTGTGGCAGG - Exonic
1122768163 14:104085545-104085567 CTGGGGGCGGGGTGGGTCCCGGG - Intergenic
1123000740 14:105292855-105292877 CTGGGGAGGGGATGTGGGCCTGG - Intronic
1125541220 15:40471123-40471145 CTGGGGGCGGGAGGAGGGTCTGG - Exonic
1127398124 15:58559460-58559482 CTTGGGGCAAGATGAGTGTCTGG - Intronic
1127866581 15:63038151-63038173 CTGGGGGCGGGGGGTGGGGCTGG - Intergenic
1129142379 15:73611825-73611847 GTGGGGGCTGTATGTGTGTGGGG + Intronic
1129320468 15:74771952-74771974 CTAGGGCCAGGATGTGTGACTGG - Intergenic
1132515260 16:363105-363127 CTGGGGACAGGATGTGGGTAGGG + Intergenic
1132553451 16:562857-562879 CAGGGGTGGGGATGTGTGTAGGG + Intronic
1132665974 16:1081535-1081557 CCGGGGGCGGGCCCTGTGTCGGG - Intergenic
1132793490 16:1706723-1706745 CTGGGGTCGGGACGGGTGTTGGG - Intronic
1133260261 16:4544725-4544747 CTGAGGGCTGGCTGTGTGCCAGG - Intergenic
1133456012 16:5943123-5943145 CTGTGTTAGGGATGTGTGTCTGG - Intergenic
1134024053 16:10941476-10941498 CTGAGGGAGGGGTGTGTATCCGG + Intronic
1134196673 16:12164191-12164213 CTGGGGTAGGGATGAGTGTGGGG + Intronic
1134592204 16:15463726-15463748 CTGGGGTGGGGATGGGGGTCAGG - Intronic
1134615788 16:15650317-15650339 CTGGGGTCGGGGTGGCTGTCCGG + Intronic
1137496161 16:48970986-48971008 CTGGGGATGGGATGTGGTTCAGG + Intergenic
1140927451 16:79598516-79598538 CTGGGGAGGGAATGGGTGTCTGG - Intronic
1141674109 16:85508576-85508598 CTGTGGCCTGGATGGGTGTCAGG + Intergenic
1142382041 16:89738362-89738384 CTGGAGGCGGGCTTGGTGTCCGG + Exonic
1142673636 17:1499734-1499756 CTGGAGGTGGGGTGTGTGTGTGG + Intronic
1143015583 17:3889704-3889726 CTGGGTGGGGGATATGTGCCAGG - Intronic
1143564989 17:7715845-7715867 CTGGGACAGGGATGTGTGTGGGG + Intergenic
1143576721 17:7798134-7798156 CTGGGGGTGGGGTGGGTGTGAGG - Intronic
1144734341 17:17546607-17546629 CTGGGGGCTGGATGGGTGGCAGG - Intronic
1144771338 17:17761319-17761341 CTGGTGGCTGCATGTGTGCCAGG - Intronic
1147050009 17:37787198-37787220 GTGGGGGCTGGATCTGTCTCCGG + Intergenic
1147688381 17:42300476-42300498 CTGGGGGTGGGATGGGGCTCGGG + Intronic
1148196516 17:45717145-45717167 GTGGGGTGGGGCTGTGTGTCTGG - Intergenic
1148733266 17:49850790-49850812 CTGAGCGCGTGCTGTGTGTCAGG - Intergenic
1148994695 17:51699454-51699476 CTGGGGGCTGTGTGTGTCTCCGG - Intronic
1149466512 17:56884295-56884317 CTGGGATTGGGATGAGTGTCTGG - Intergenic
1150252397 17:63714146-63714168 CTGGGGGTGGGATGGGAGTGGGG + Intronic
1150692307 17:67377282-67377304 CTGGGGCCGGGAGGTGGGTGCGG - Intronic
1151569332 17:74918260-74918282 CTGGGGCAGGGATGGGTGTGGGG - Intronic
1151573931 17:74941799-74941821 CTGGGTGCGGGGTGAGTGTCAGG + Exonic
1151680201 17:75619088-75619110 CTGGGGGTGGGCTCTGTCTCAGG + Intergenic
1151775804 17:76200961-76200983 CTGGGGTTGGGATGTGTGCCAGG - Intronic
1152077611 17:78168919-78168941 CTGGGGGTGGGGTGGGTGGCGGG - Intronic
1152391438 17:80006148-80006170 CTGGGGTGGGGAGGGGTGTCAGG - Intronic
1152778912 17:82217913-82217935 GTGGGGCCGGGCTGTGTGGCAGG - Intergenic
1152838160 17:82548772-82548794 CTGGGGGAGGCATGGGTGTTTGG + Intronic
1153316485 18:3727570-3727592 CTGGGAACGGGTTGTGTGTTGGG + Intronic
1154295344 18:13142284-13142306 CTGGAGGCAGCCTGTGTGTCAGG - Intergenic
1155872054 18:31041973-31041995 CTGGGGGCGGGATGTGCCGGGGG - Intronic
1158418937 18:57275512-57275534 CTGGAGGAGGGAGGTCTGTCTGG - Intergenic
1160751119 19:735168-735190 CTGGGTGGGGTCTGTGTGTCTGG + Intronic
1160751134 19:735217-735239 CTGGGTGGGGTCTGTGTGTCTGG + Intronic
1162721723 19:12666744-12666766 CTGGGGGCGGGGCGTTTGCCCGG - Intronic
1164634658 19:29783518-29783540 CTGGGGGCGAGAGGTGGGTCTGG + Intergenic
1167336075 19:48886686-48886708 CTGGGGGCAGGATTTATCTCAGG + Intronic
1167698145 19:51026712-51026734 CCCGGGGCGGGGTGTGTGTGAGG + Intronic
1168258258 19:55178983-55179005 CTGGAGTCGGGAGGCGTGTCGGG + Exonic
925493624 2:4422729-4422751 CTCGGGGGGGTGTGTGTGTCAGG + Intergenic
925594236 2:5539598-5539620 CTGGGGTCAGGAGGTGTCTCTGG - Intergenic
925991790 2:9260322-9260344 CTGGGGGCGGGAAGGATGCCTGG + Intronic
925999075 2:9315602-9315624 CTGGAGGCGGGAACTGTGACGGG + Intronic
926108015 2:10164672-10164694 CTAGGGGAGGGATGTGGGTGTGG + Intronic
926137512 2:10347136-10347158 CTGAGGCCGGCCTGTGTGTCAGG - Intronic
931807699 2:65823713-65823735 CTGGGAGTGGAATGTGTGTGAGG + Intergenic
932114624 2:69035156-69035178 CGGGGGGCGGGGTGGGGGTCTGG + Intronic
932620915 2:73264564-73264586 CTGGTGTGGGGATGTGTGTGGGG + Intronic
933609844 2:84422420-84422442 CTGGGGAGGGGATGTGAGTTGGG - Intergenic
933858549 2:86441828-86441850 CTGGGGCCCGGGTGTGTGGCGGG + Intronic
935218600 2:100993378-100993400 CTGTTGGCGGGGTGTGCGTCTGG - Exonic
938162430 2:128997720-128997742 CTGGGCTCGGGGTCTGTGTCTGG - Intergenic
938211037 2:129465777-129465799 CTGGGGGCAGGTTTGGTGTCTGG - Intergenic
941631683 2:167891435-167891457 CTCGGGGGAGGATGTGAGTCTGG - Intergenic
946365445 2:219246075-219246097 CTGGGGGAGGGGTGAGTGTTTGG + Exonic
948163844 2:235845832-235845854 TTGGGGCCTGGATGTGTGTTTGG + Intronic
948555041 2:238803763-238803785 CTGGGTGCGGGAATGGTGTCTGG + Intergenic
948965039 2:241372694-241372716 CTGGTGGCGAGAGGTGTGCCAGG + Intronic
1169000858 20:2166979-2167001 CTGGGAGCTGCATCTGTGTCTGG + Intronic
1170469986 20:16659075-16659097 CTTGGGGGGGCATATGTGTCCGG + Intergenic
1174276397 20:49407656-49407678 CTGGGTGGGGGTTGTGTGTGGGG + Intronic
1174454290 20:50638599-50638621 CTGTGGGGTGGCTGTGTGTCGGG + Intronic
1175256660 20:57652109-57652131 CTAGGGGCGCGATGTGTGTGTGG + Exonic
1175538797 20:59735300-59735322 CTGAGGGCCTGCTGTGTGTCAGG - Intronic
1175889738 20:62310830-62310852 CTGGGGGCAGGAGATGGGTCAGG + Intronic
1175904726 20:62374113-62374135 CTGGGGGGCTGATGTGGGTCAGG - Intergenic
1179518701 21:41927905-41927927 CTGGGGGCGGGGTTGGAGTCAGG - Intronic
1179797739 21:43795046-43795068 CTGGGGGCCGGCTGTGTGCTGGG + Intronic
1179929134 21:44555659-44555681 AGGGGGGTGGGATGTGTGTGTGG - Intronic
1181854944 22:25774802-25774824 CTGGGGTCTGGGTGTGTGCCTGG + Intronic
1182345229 22:29658602-29658624 ATGGGGGTGGGGTGTGTGTTGGG - Intronic
1182668343 22:31975031-31975053 CTGGTGGAGGGATGTGGGTAGGG + Intergenic
1183055369 22:35301810-35301832 CTGTGGGGTGGGTGTGTGTCCGG - Intronic
1185150091 22:49159315-49159337 CATGGGGCGGGCTGTGTGGCTGG + Intergenic
1185151231 22:49164863-49164885 CTGGGGGAGGGCTGTGGGTGGGG - Intergenic
1185409357 22:50674231-50674253 GTGGGGGCGGGAGGTGTGTGCGG - Intergenic
950380820 3:12613421-12613443 CTGGGGGCGGGGTGTGGGGGGGG - Intronic
950965077 3:17140304-17140326 CTGGGGTTGGGATGTGGGGCTGG + Intergenic
954886869 3:53882272-53882294 CTGGGGGCGGGGTGTGCATGCGG + Intergenic
955042014 3:55327070-55327092 CTGGGGGCGGGGTGGGGGTGGGG - Intergenic
957054802 3:75435244-75435266 CTGGGGGCGGGCTGTAGGGCGGG + Intergenic
961785191 3:129343308-129343330 GTGGGGGGGGGATGTGAGCCTGG - Intergenic
962314798 3:134352628-134352650 CTGGGGGCTGGAGGTTTGGCTGG + Intergenic
962736272 3:138328344-138328366 CTGGGGGTGGGAGGGGTGTGGGG - Intronic
965607990 3:170515605-170515627 CTGGGGTTAGGATGTGTGTTGGG + Intronic
966913553 3:184572611-184572633 CTGGCGGCGGGATGTGCAGCGGG + Exonic
967069074 3:185946366-185946388 CTGGGGTGAGGATGTTTGTCGGG + Intergenic
968974792 4:3816424-3816446 CAGGGGCCGGGATGTGGGCCTGG + Intergenic
971389809 4:26175376-26175398 CTGGGGGGGGGATTTGAGTCTGG + Intronic
972530315 4:39955663-39955685 CTGTGGGAGGCATGTGTGACTGG + Intronic
977258141 4:94762878-94762900 CTGGGGGCTGGGGGTGTGCCAGG + Intronic
978440667 4:108730164-108730186 CTGTGGGAGGAATGTGTGTAAGG - Intergenic
982230593 4:153205212-153205234 CTGGGGACGCCATGTGAGTCGGG + Intronic
983534715 4:168845063-168845085 AGGGGGGAGGGCTGTGTGTCCGG + Intronic
985683687 5:1270827-1270849 CGAGGGGCGGGGGGTGTGTCTGG - Intronic
986471436 5:8080775-8080797 CTGGGGTCTGTATGTGTCTCTGG - Intergenic
988613588 5:32751668-32751690 AGGGGGGTGGGATGTGTGTTTGG + Intronic
992890629 5:81200934-81200956 TTGGGGGCGTGGTGTGTGTTGGG + Intronic
998108711 5:139484923-139484945 CTTGGGGTGGGAAGTGTCTCTGG + Intergenic
998136557 5:139677168-139677190 TTGGGGGCTGGATGTGTTCCTGG + Intronic
998148393 5:139743422-139743444 GTGGGGGTGGAATGTGTGTTTGG + Intergenic
1001755609 5:174166276-174166298 TTGGTGGAGGGATGAGTGTCCGG + Intronic
1002213597 5:177612439-177612461 CTGGAGCCAGCATGTGTGTCAGG + Intergenic
1002539047 5:179894005-179894027 CTGTGGCCGGGATGTCTGTAGGG + Intronic
1003665054 6:8102691-8102713 CTGAGGGCGGGGTGTGAGACAGG + Intergenic
1004381124 6:15133479-15133501 CTAGGGGCAGGATGTGTGCAGGG - Intergenic
1005380013 6:25224371-25224393 ATGGGGGCAGGATGTGTATGGGG - Intergenic
1005652225 6:27894887-27894909 CTTGGGGAGGGAGGTGTGCCAGG + Intergenic
1005986877 6:30881220-30881242 CTGGAGGCTGGAGGTGTGTTGGG + Intronic
1007719988 6:43879199-43879221 CTGGGGCTGGGGTGTGTGTAGGG - Intergenic
1010902320 6:81442530-81442552 CTGTGGGTGGCATGTGTGTGTGG + Intergenic
1013050978 6:106534806-106534828 TTGGGGGCGGGGTGTGTGTAGGG + Intronic
1014035663 6:116764977-116764999 CTGGAGGCGGGGTGTGTGTGTGG + Intronic
1015860522 6:137673790-137673812 TTGGGTGTGGGCTGTGTGTCAGG + Intergenic
1017903014 6:158734525-158734547 CTGGAGGTGGGATGTGTCTGGGG - Intronic
1019268619 7:133677-133699 TCGGGGGCGGGATGTGTGGCTGG - Intergenic
1019304293 7:325553-325575 CTGGGGCCAGGAGGTGTGTGGGG - Intergenic
1020891594 7:13885015-13885037 CTGAGGGCTGGATCTGTTTCAGG - Intergenic
1022043141 7:26599794-26599816 CTGGGGAGGGGAGGTGTGTGAGG + Intergenic
1022505386 7:30906207-30906229 CTGGGGGTGGCATCTGTGCCAGG - Intergenic
1023004884 7:35853428-35853450 CTGGGCGGGGGAAGTGGGTCAGG + Intronic
1030145171 7:106345740-106345762 CTGGGGGCAGGAGGTGGGGCAGG - Intergenic
1031575314 7:123409361-123409383 CTGGGGGCAGGAGGAGTGTGTGG - Intergenic
1032426977 7:131830260-131830282 CTGGGGGCTGGTTGTGGGCCAGG + Intergenic
1033216380 7:139496350-139496372 CTGAGGGCTGGATGTGTGGCGGG - Intergenic
1034349067 7:150404978-150405000 CTGGGGGCGGTTTGTGGGCCTGG + Intronic
1034954319 7:155324924-155324946 CTGGGGGCTCGATGCGTGTCAGG + Intergenic
1035021574 7:155803879-155803901 TTGGGGGAGGGAGGTGTGTGCGG - Intronic
1038054168 8:23842668-23842690 CTGGGGGTGGGAAGTGTGGGAGG + Exonic
1042725224 8:71868097-71868119 CTGGGGGCTGGGTGTGTGTGTGG + Intronic
1046094375 8:109539964-109539986 CTGGGGTCGGGATGGGGGTAGGG - Intronic
1047409282 8:124611098-124611120 CTGGGGGGGGGGGGTCTGTCTGG - Intronic
1047454622 8:124998170-124998192 CTGGGGCCGGGATCGGCGTCGGG - Intergenic
1048857125 8:138694955-138694977 CTGGAGGTGGCCTGTGTGTCCGG - Intronic
1048893189 8:138965977-138965999 CTGGGTGCCTGATGTGTGCCAGG + Intergenic
1048988750 8:139749219-139749241 CTGGGGGCTGGATGTGCTTCAGG - Intronic
1049335636 8:142083191-142083213 CTGGGGGGTGTGTGTGTGTCCGG - Intergenic
1049756996 8:144315242-144315264 CTGGTGGGGGGATGGGTGTGGGG - Exonic
1050362395 9:4842902-4842924 CTGGTGGCAGGATGGCTGTCAGG - Intronic
1050537871 9:6645740-6645762 CTGGAGGCGGGAGGTGGGTTGGG + Intergenic
1051170440 9:14314985-14315007 CTGGGGGCGGCCTGGGTGTGAGG - Intronic
1056078111 9:83062401-83062423 CTGGGGGCGGGAGGTTATTCTGG - Intronic
1056753921 9:89370920-89370942 TTGGGGGGGTGTTGTGTGTCTGG + Intronic
1056754192 9:89372063-89372085 TTGGGGGCGTGGTGTGTGTCGGG + Intronic
1056754211 9:89372133-89372155 TGGGGGGCGTGGTGTGTGTCGGG + Intronic
1057267970 9:93631292-93631314 GTGGGGGCTGCATGTGTTTCAGG + Intronic
1058144653 9:101398570-101398592 ATGGCGGCGCGATCTGTGTCGGG - Exonic
1059107657 9:111525326-111525348 CTTGGGGCGGGATGGGGGCCGGG + Intronic
1061296691 9:129680682-129680704 CTGGGGGCGGGGTGTTGGGCTGG - Intronic
1062210488 9:135360991-135361013 CTGGGGGTGGGAAGAGTGCCTGG - Intergenic
1062475091 9:136722734-136722756 CAGGAGGCGGGAGGTCTGTCTGG + Intronic
1062478224 9:136740109-136740131 CTGGGGTAGGGATGGGGGTCAGG - Intronic
1062529127 9:136992268-136992290 TTGGGGGCGGGGTCTGTGTGTGG - Intergenic
1190988670 X:55523040-55523062 CTGAAGGCGGGCTGTGTGTGTGG + Intergenic
1192224925 X:69221620-69221642 CTGGGGGCAGGATGGGGGTGGGG - Intergenic
1192429032 X:71100335-71100357 CTGGGAGCGGGAAATGTGTGTGG + Intronic
1195282293 X:103348133-103348155 GTGGGGGCGGAGTGTGTGTACGG - Intergenic
1197871582 X:131067290-131067312 CTGGGCGGGGGAGGGGTGTCAGG + Intronic
1197890451 X:131264885-131264907 CTGCGGGCGGGGTGTGTGAAGGG - Intergenic
1200047042 X:153408711-153408733 GTGGGGACAGGATGTGTGTCTGG - Intergenic
1200091031 X:153636067-153636089 TTGGGGGAGGGATGAGTGTCGGG - Intergenic
1200110597 X:153738860-153738882 CTGGAGGCGGGCTGTGTGCAGGG - Intronic
1200253522 X:154566698-154566720 CTGGGGGCGGGGTGTGGGGGCGG + Intergenic
1200264245 X:154637710-154637732 CTGGGGGCGGGGTGTGGGGGCGG - Intergenic
1201150967 Y:11095439-11095461 CTGGGGTCTGGATGTCAGTCTGG - Intergenic