ID: 900137473

View in Genome Browser
Species Human (GRCh38)
Location 1:1124463-1124485
Sequence CACCCAGTCCGCTCACTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900137466_900137473 14 Left 900137466 1:1124426-1124448 CCACGTGAATTCTGGGCGTGGTT No data
Right 900137473 1:1124463-1124485 CACCCAGTCCGCTCACTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900137473 Original CRISPR CACCCAGTCCGCTCACTGCT TGG Intergenic
No off target data available for this crispr