ID: 900138195

View in Genome Browser
Species Human (GRCh38)
Location 1:1127686-1127708
Sequence GGGCTACGCCCAGCCCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900138183_900138195 16 Left 900138183 1:1127647-1127669 CCTGGGCCTAGGTGGCCAGGTCT No data
Right 900138195 1:1127686-1127708 GGGCTACGCCCAGCCCCACCCGG No data
900138176_900138195 29 Left 900138176 1:1127634-1127656 CCCCGGGTGCTGCCCTGGGCCTA No data
Right 900138195 1:1127686-1127708 GGGCTACGCCCAGCCCCACCCGG No data
900138178_900138195 27 Left 900138178 1:1127636-1127658 CCGGGTGCTGCCCTGGGCCTAGG No data
Right 900138195 1:1127686-1127708 GGGCTACGCCCAGCCCCACCCGG No data
900138182_900138195 17 Left 900138182 1:1127646-1127668 CCCTGGGCCTAGGTGGCCAGGTC No data
Right 900138195 1:1127686-1127708 GGGCTACGCCCAGCCCCACCCGG No data
900138177_900138195 28 Left 900138177 1:1127635-1127657 CCCGGGTGCTGCCCTGGGCCTAG No data
Right 900138195 1:1127686-1127708 GGGCTACGCCCAGCCCCACCCGG No data
900138190_900138195 1 Left 900138190 1:1127662-1127684 CCAGGTCTGGGGGGCCGATACCA No data
Right 900138195 1:1127686-1127708 GGGCTACGCCCAGCCCCACCCGG No data
900138188_900138195 10 Left 900138188 1:1127653-1127675 CCTAGGTGGCCAGGTCTGGGGGG No data
Right 900138195 1:1127686-1127708 GGGCTACGCCCAGCCCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900138195 Original CRISPR GGGCTACGCCCAGCCCCACC CGG Intergenic
No off target data available for this crispr