ID: 900142898

View in Genome Browser
Species Human (GRCh38)
Location 1:1145918-1145940
Sequence GAGCCTGTCCACTGCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900142884_900142898 25 Left 900142884 1:1145870-1145892 CCACAGGGGATCCCGCAGAGCCC No data
Right 900142898 1:1145918-1145940 GAGCCTGTCCACTGCCTTCCTGG No data
900142895_900142898 -5 Left 900142895 1:1145900-1145922 CCCATCCTGGTGGGAGAGGAGCC No data
Right 900142898 1:1145918-1145940 GAGCCTGTCCACTGCCTTCCTGG No data
900142894_900142898 -4 Left 900142894 1:1145899-1145921 CCCCATCCTGGTGGGAGAGGAGC No data
Right 900142898 1:1145918-1145940 GAGCCTGTCCACTGCCTTCCTGG No data
900142897_900142898 -10 Left 900142897 1:1145905-1145927 CCTGGTGGGAGAGGAGCCTGTCC No data
Right 900142898 1:1145918-1145940 GAGCCTGTCCACTGCCTTCCTGG No data
900142887_900142898 13 Left 900142887 1:1145882-1145904 CCGCAGAGCCCTCTCGGCCCCAT No data
Right 900142898 1:1145918-1145940 GAGCCTGTCCACTGCCTTCCTGG No data
900142886_900142898 14 Left 900142886 1:1145881-1145903 CCCGCAGAGCCCTCTCGGCCCCA No data
Right 900142898 1:1145918-1145940 GAGCCTGTCCACTGCCTTCCTGG No data
900142891_900142898 4 Left 900142891 1:1145891-1145913 CCTCTCGGCCCCATCCTGGTGGG No data
Right 900142898 1:1145918-1145940 GAGCCTGTCCACTGCCTTCCTGG No data
900142896_900142898 -6 Left 900142896 1:1145901-1145923 CCATCCTGGTGGGAGAGGAGCCT No data
Right 900142898 1:1145918-1145940 GAGCCTGTCCACTGCCTTCCTGG No data
900142889_900142898 5 Left 900142889 1:1145890-1145912 CCCTCTCGGCCCCATCCTGGTGG No data
Right 900142898 1:1145918-1145940 GAGCCTGTCCACTGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900142898 Original CRISPR GAGCCTGTCCACTGCCTTCC TGG Intergenic