ID: 900144022

View in Genome Browser
Species Human (GRCh38)
Location 1:1150303-1150325
Sequence TGCCCTGTGTTCCTTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900144018_900144022 -4 Left 900144018 1:1150284-1150306 CCTGCAGGAAGGCCTTGCCTGCC No data
Right 900144022 1:1150303-1150325 TGCCCTGTGTTCCTTCCTGGAGG No data
900144011_900144022 17 Left 900144011 1:1150263-1150285 CCACCCAGGTGGGTCCCAGCACC No data
Right 900144022 1:1150303-1150325 TGCCCTGTGTTCCTTCCTGGAGG No data
900144013_900144022 13 Left 900144013 1:1150267-1150289 CCAGGTGGGTCCCAGCACCTGCA No data
Right 900144022 1:1150303-1150325 TGCCCTGTGTTCCTTCCTGGAGG No data
900144012_900144022 14 Left 900144012 1:1150266-1150288 CCCAGGTGGGTCCCAGCACCTGC No data
Right 900144022 1:1150303-1150325 TGCCCTGTGTTCCTTCCTGGAGG No data
900144010_900144022 18 Left 900144010 1:1150262-1150284 CCCACCCAGGTGGGTCCCAGCAC No data
Right 900144022 1:1150303-1150325 TGCCCTGTGTTCCTTCCTGGAGG No data
900144017_900144022 2 Left 900144017 1:1150278-1150300 CCAGCACCTGCAGGAAGGCCTTG No data
Right 900144022 1:1150303-1150325 TGCCCTGTGTTCCTTCCTGGAGG No data
900144016_900144022 3 Left 900144016 1:1150277-1150299 CCCAGCACCTGCAGGAAGGCCTT No data
Right 900144022 1:1150303-1150325 TGCCCTGTGTTCCTTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900144022 Original CRISPR TGCCCTGTGTTCCTTCCTGG AGG Intergenic
No off target data available for this crispr