ID: 900144194

View in Genome Browser
Species Human (GRCh38)
Location 1:1150839-1150861
Sequence CTAGAGGCCCAGAGGGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900144194_900144210 13 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144210 1:1150875-1150897 GGTGCCGGGGAGCAGAGGTGAGG No data
900144194_900144211 14 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144211 1:1150876-1150898 GTGCCGGGGAGCAGAGGTGAGGG No data
900144194_900144201 -10 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144201 1:1150852-1150874 GGGCCTCTAGGAGCCTGGGAGGG No data
900144194_900144215 20 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144215 1:1150882-1150904 GGGAGCAGAGGTGAGGGGCCGGG No data
900144194_900144212 15 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144212 1:1150877-1150899 TGCCGGGGAGCAGAGGTGAGGGG No data
900144194_900144203 -8 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144203 1:1150854-1150876 GCCTCTAGGAGCCTGGGAGGGGG No data
900144194_900144218 25 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144218 1:1150887-1150909 CAGAGGTGAGGGGCCGGGAGGGG No data
900144194_900144214 19 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144214 1:1150881-1150903 GGGGAGCAGAGGTGAGGGGCCGG No data
900144194_900144202 -9 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144202 1:1150853-1150875 GGCCTCTAGGAGCCTGGGAGGGG No data
900144194_900144217 24 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144217 1:1150886-1150908 GCAGAGGTGAGGGGCCGGGAGGG No data
900144194_900144206 -1 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144206 1:1150861-1150883 GGAGCCTGGGAGGGGGTGCCGGG No data
900144194_900144209 8 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144209 1:1150870-1150892 GAGGGGGTGCCGGGGAGCAGAGG No data
900144194_900144207 0 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144207 1:1150862-1150884 GAGCCTGGGAGGGGGTGCCGGGG No data
900144194_900144205 -2 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144205 1:1150860-1150882 AGGAGCCTGGGAGGGGGTGCCGG No data
900144194_900144216 23 Left 900144194 1:1150839-1150861 CCAGATTCCCTCTGGGCCTCTAG No data
Right 900144216 1:1150885-1150907 AGCAGAGGTGAGGGGCCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900144194 Original CRISPR CTAGAGGCCCAGAGGGAATC TGG (reversed) Intergenic
No off target data available for this crispr