ID: 900145166

View in Genome Browser
Species Human (GRCh38)
Location 1:1156059-1156081
Sequence TGACGAGGGAACGGAGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900145166_900145175 17 Left 900145166 1:1156059-1156081 CCACAGCCTCCGTTCCCTCGTCA No data
Right 900145175 1:1156099-1156121 ACTTCCACCCAGGCTCTGCCGGG No data
900145166_900145174 16 Left 900145166 1:1156059-1156081 CCACAGCCTCCGTTCCCTCGTCA No data
Right 900145174 1:1156098-1156120 CACTTCCACCCAGGCTCTGCCGG No data
900145166_900145172 7 Left 900145166 1:1156059-1156081 CCACAGCCTCCGTTCCCTCGTCA No data
Right 900145172 1:1156089-1156111 AAGCCAGTGCACTTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900145166 Original CRISPR TGACGAGGGAACGGAGGCTG TGG (reversed) Intergenic
No off target data available for this crispr