ID: 900145838

View in Genome Browser
Species Human (GRCh38)
Location 1:1158341-1158363
Sequence TCGGGCCCAGCCAGGGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900145828_900145838 -7 Left 900145828 1:1158325-1158347 CCCGCCCAGCGAGACCTCGGGCC No data
Right 900145838 1:1158341-1158363 TCGGGCCCAGCCAGGGCTGGGGG No data
900145824_900145838 -2 Left 900145824 1:1158320-1158342 CCTGCCCCGCCCAGCGAGACCTC No data
Right 900145838 1:1158341-1158363 TCGGGCCCAGCCAGGGCTGGGGG No data
900145819_900145838 30 Left 900145819 1:1158288-1158310 CCCGAGCCAGAGCACAAAGGGCC No data
Right 900145838 1:1158341-1158363 TCGGGCCCAGCCAGGGCTGGGGG No data
900145829_900145838 -8 Left 900145829 1:1158326-1158348 CCGCCCAGCGAGACCTCGGGCCC No data
Right 900145838 1:1158341-1158363 TCGGGCCCAGCCAGGGCTGGGGG No data
900145820_900145838 29 Left 900145820 1:1158289-1158311 CCGAGCCAGAGCACAAAGGGCCT No data
Right 900145838 1:1158341-1158363 TCGGGCCCAGCCAGGGCTGGGGG No data
900145822_900145838 9 Left 900145822 1:1158309-1158331 CCTTTGTCCTGCCTGCCCCGCCC No data
Right 900145838 1:1158341-1158363 TCGGGCCCAGCCAGGGCTGGGGG No data
900145823_900145838 2 Left 900145823 1:1158316-1158338 CCTGCCTGCCCCGCCCAGCGAGA No data
Right 900145838 1:1158341-1158363 TCGGGCCCAGCCAGGGCTGGGGG No data
900145821_900145838 24 Left 900145821 1:1158294-1158316 CCAGAGCACAAAGGGCCTTTGTC No data
Right 900145838 1:1158341-1158363 TCGGGCCCAGCCAGGGCTGGGGG No data
900145827_900145838 -6 Left 900145827 1:1158324-1158346 CCCCGCCCAGCGAGACCTCGGGC No data
Right 900145838 1:1158341-1158363 TCGGGCCCAGCCAGGGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900145838 Original CRISPR TCGGGCCCAGCCAGGGCTGG GGG Intergenic