ID: 900146025

View in Genome Browser
Species Human (GRCh38)
Location 1:1158951-1158973
Sequence GCTGCTGGAGGACCCCGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146025_900146033 8 Left 900146025 1:1158951-1158973 CCAGCTCGGGGTCCTCCAGCAGC No data
Right 900146033 1:1158982-1159004 GGTTCATCCAGGATGAAAGCAGG No data
900146025_900146029 -3 Left 900146025 1:1158951-1158973 CCAGCTCGGGGTCCTCCAGCAGC No data
Right 900146029 1:1158971-1158993 AGCCATACCCAGGTTCATCCAGG No data
900146025_900146034 9 Left 900146025 1:1158951-1158973 CCAGCTCGGGGTCCTCCAGCAGC No data
Right 900146034 1:1158983-1159005 GTTCATCCAGGATGAAAGCAGGG No data
900146025_900146038 30 Left 900146025 1:1158951-1158973 CCAGCTCGGGGTCCTCCAGCAGC No data
Right 900146038 1:1159004-1159026 GGCAGTGGGAACCACGTGATTGG No data
900146025_900146037 16 Left 900146025 1:1158951-1158973 CCAGCTCGGGGTCCTCCAGCAGC No data
Right 900146037 1:1158990-1159012 CAGGATGAAAGCAGGGCAGTGGG No data
900146025_900146036 15 Left 900146025 1:1158951-1158973 CCAGCTCGGGGTCCTCCAGCAGC No data
Right 900146036 1:1158989-1159011 CCAGGATGAAAGCAGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146025 Original CRISPR GCTGCTGGAGGACCCCGAGC TGG (reversed) Intergenic
No off target data available for this crispr