ID: 900146029

View in Genome Browser
Species Human (GRCh38)
Location 1:1158971-1158993
Sequence AGCCATACCCAGGTTCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146015_900146029 28 Left 900146015 1:1158920-1158942 CCGAGGGCCCTGGGGCCTGGGTA No data
Right 900146029 1:1158971-1158993 AGCCATACCCAGGTTCATCCAGG No data
900146014_900146029 29 Left 900146014 1:1158919-1158941 CCCGAGGGCCCTGGGGCCTGGGT No data
Right 900146029 1:1158971-1158993 AGCCATACCCAGGTTCATCCAGG No data
900146018_900146029 21 Left 900146018 1:1158927-1158949 CCCTGGGGCCTGGGTAGGGACTG No data
Right 900146029 1:1158971-1158993 AGCCATACCCAGGTTCATCCAGG No data
900146021_900146029 13 Left 900146021 1:1158935-1158957 CCTGGGTAGGGACTGGCCAGCTC No data
Right 900146029 1:1158971-1158993 AGCCATACCCAGGTTCATCCAGG No data
900146019_900146029 20 Left 900146019 1:1158928-1158950 CCTGGGGCCTGGGTAGGGACTGG No data
Right 900146029 1:1158971-1158993 AGCCATACCCAGGTTCATCCAGG No data
900146025_900146029 -3 Left 900146025 1:1158951-1158973 CCAGCTCGGGGTCCTCCAGCAGC No data
Right 900146029 1:1158971-1158993 AGCCATACCCAGGTTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146029 Original CRISPR AGCCATACCCAGGTTCATCC AGG Intergenic
No off target data available for this crispr