ID: 900146034

View in Genome Browser
Species Human (GRCh38)
Location 1:1158983-1159005
Sequence GTTCATCCAGGATGAAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146027_900146034 -3 Left 900146027 1:1158963-1158985 CCTCCAGCAGCCATACCCAGGTT No data
Right 900146034 1:1158983-1159005 GTTCATCCAGGATGAAAGCAGGG No data
900146021_900146034 25 Left 900146021 1:1158935-1158957 CCTGGGTAGGGACTGGCCAGCTC No data
Right 900146034 1:1158983-1159005 GTTCATCCAGGATGAAAGCAGGG No data
900146025_900146034 9 Left 900146025 1:1158951-1158973 CCAGCTCGGGGTCCTCCAGCAGC No data
Right 900146034 1:1158983-1159005 GTTCATCCAGGATGAAAGCAGGG No data
900146028_900146034 -6 Left 900146028 1:1158966-1158988 CCAGCAGCCATACCCAGGTTCAT No data
Right 900146034 1:1158983-1159005 GTTCATCCAGGATGAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146034 Original CRISPR GTTCATCCAGGATGAAAGCA GGG Intergenic
No off target data available for this crispr