ID: 900146036

View in Genome Browser
Species Human (GRCh38)
Location 1:1158989-1159011
Sequence CCAGGATGAAAGCAGGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146030_900146036 -7 Left 900146030 1:1158973-1158995 CCATACCCAGGTTCATCCAGGAT No data
Right 900146036 1:1158989-1159011 CCAGGATGAAAGCAGGGCAGTGG No data
900146025_900146036 15 Left 900146025 1:1158951-1158973 CCAGCTCGGGGTCCTCCAGCAGC No data
Right 900146036 1:1158989-1159011 CCAGGATGAAAGCAGGGCAGTGG No data
900146027_900146036 3 Left 900146027 1:1158963-1158985 CCTCCAGCAGCCATACCCAGGTT No data
Right 900146036 1:1158989-1159011 CCAGGATGAAAGCAGGGCAGTGG No data
900146028_900146036 0 Left 900146028 1:1158966-1158988 CCAGCAGCCATACCCAGGTTCAT No data
Right 900146036 1:1158989-1159011 CCAGGATGAAAGCAGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146036 Original CRISPR CCAGGATGAAAGCAGGGCAG TGG Intergenic
No off target data available for this crispr