ID: 900146472

View in Genome Browser
Species Human (GRCh38)
Location 1:1160979-1161001
Sequence GGCGGGGCTCTTCCCGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146472_900146486 28 Left 900146472 1:1160979-1161001 CCACAGCCGGGAAGAGCCCCGCC No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146472_900146487 29 Left 900146472 1:1160979-1161001 CCACAGCCGGGAAGAGCCCCGCC No data
Right 900146487 1:1161031-1161053 ACCACCGAAGCCCCCAGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146472 Original CRISPR GGCGGGGCTCTTCCCGGCTG TGG (reversed) Intergenic
No off target data available for this crispr