ID: 900146474

View in Genome Browser
Species Human (GRCh38)
Location 1:1160995-1161017
Sequence GGTGGTGGGTGGTGAAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146474_900146486 12 Left 900146474 1:1160995-1161017 CCCCGCCTTCACCACCCACCACC No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146474_900146487 13 Left 900146474 1:1160995-1161017 CCCCGCCTTCACCACCCACCACC No data
Right 900146487 1:1161031-1161053 ACCACCGAAGCCCCCAGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146474 Original CRISPR GGTGGTGGGTGGTGAAGGCG GGG (reversed) Intergenic
No off target data available for this crispr