ID: 900146476

View in Genome Browser
Species Human (GRCh38)
Location 1:1160997-1161019
Sequence CTGGTGGTGGGTGGTGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146476_900146486 10 Left 900146476 1:1160997-1161019 CCGCCTTCACCACCCACCACCAG No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146476_900146487 11 Left 900146476 1:1160997-1161019 CCGCCTTCACCACCCACCACCAG No data
Right 900146487 1:1161031-1161053 ACCACCGAAGCCCCCAGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146476 Original CRISPR CTGGTGGTGGGTGGTGAAGG CGG (reversed) Intergenic
No off target data available for this crispr