ID: 900146477

View in Genome Browser
Species Human (GRCh38)
Location 1:1161000-1161022
Sequence TGGCTGGTGGTGGGTGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146477_900146487 8 Left 900146477 1:1161000-1161022 CCTTCACCACCCACCACCAGCCA No data
Right 900146487 1:1161031-1161053 ACCACCGAAGCCCCCAGACCGGG No data
900146477_900146486 7 Left 900146477 1:1161000-1161022 CCTTCACCACCCACCACCAGCCA No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146477 Original CRISPR TGGCTGGTGGTGGGTGGTGA AGG (reversed) Intergenic
No off target data available for this crispr