ID: 900146480

View in Genome Browser
Species Human (GRCh38)
Location 1:1161010-1161032
Sequence GTCTCGGGATTGGCTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146480_900146497 22 Left 900146480 1:1161010-1161032 CCACCACCAGCCAATCCCGAGAC No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146480_900146486 -3 Left 900146480 1:1161010-1161032 CCACCACCAGCCAATCCCGAGAC No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146480_900146487 -2 Left 900146480 1:1161010-1161032 CCACCACCAGCCAATCCCGAGAC No data
Right 900146487 1:1161031-1161053 ACCACCGAAGCCCCCAGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146480 Original CRISPR GTCTCGGGATTGGCTGGTGG TGG (reversed) Intergenic
No off target data available for this crispr