ID: 900146486

View in Genome Browser
Species Human (GRCh38)
Location 1:1161030-1161052
Sequence GACCACCGAAGCCCCCAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146473_900146486 22 Left 900146473 1:1160985-1161007 CCGGGAAGAGCCCCGCCTTCACC No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146479_900146486 -2 Left 900146479 1:1161009-1161031 CCCACCACCAGCCAATCCCGAGA No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146481_900146486 -6 Left 900146481 1:1161013-1161035 CCACCAGCCAATCCCGAGACCAC No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146482_900146486 -9 Left 900146482 1:1161016-1161038 CCAGCCAATCCCGAGACCACCGA No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146472_900146486 28 Left 900146472 1:1160979-1161001 CCACAGCCGGGAAGAGCCCCGCC No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146477_900146486 7 Left 900146477 1:1161000-1161022 CCTTCACCACCCACCACCAGCCA No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146480_900146486 -3 Left 900146480 1:1161010-1161032 CCACCACCAGCCAATCCCGAGAC No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146478_900146486 1 Left 900146478 1:1161006-1161028 CCACCCACCACCAGCCAATCCCG No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146476_900146486 10 Left 900146476 1:1160997-1161019 CCGCCTTCACCACCCACCACCAG No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146474_900146486 12 Left 900146474 1:1160995-1161017 CCCCGCCTTCACCACCCACCACC No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data
900146475_900146486 11 Left 900146475 1:1160996-1161018 CCCGCCTTCACCACCCACCACCA No data
Right 900146486 1:1161030-1161052 GACCACCGAAGCCCCCAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146486 Original CRISPR GACCACCGAAGCCCCCAGAC CGG Intergenic
No off target data available for this crispr