ID: 900146497

View in Genome Browser
Species Human (GRCh38)
Location 1:1161055-1161077
Sequence CCTTTGCCCCTCCTGCCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146483_900146497 12 Left 900146483 1:1161020-1161042 CCAATCCCGAGACCACCGAAGCC No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146484_900146497 7 Left 900146484 1:1161025-1161047 CCCGAGACCACCGAAGCCCCCAG No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146478_900146497 26 Left 900146478 1:1161006-1161028 CCACCCACCACCAGCCAATCCCG No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146481_900146497 19 Left 900146481 1:1161013-1161035 CCACCAGCCAATCCCGAGACCAC No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146479_900146497 23 Left 900146479 1:1161009-1161031 CCCACCACCAGCCAATCCCGAGA No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146485_900146497 6 Left 900146485 1:1161026-1161048 CCGAGACCACCGAAGCCCCCAGA No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146489_900146497 -3 Left 900146489 1:1161035-1161057 CCGAAGCCCCCAGACCGGGCCCT No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146488_900146497 0 Left 900146488 1:1161032-1161054 CCACCGAAGCCCCCAGACCGGGC No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146490_900146497 -9 Left 900146490 1:1161041-1161063 CCCCCAGACCGGGCCCTTTGCCC No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146482_900146497 16 Left 900146482 1:1161016-1161038 CCAGCCAATCCCGAGACCACCGA No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146480_900146497 22 Left 900146480 1:1161010-1161032 CCACCACCAGCCAATCCCGAGAC No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data
900146491_900146497 -10 Left 900146491 1:1161042-1161064 CCCCAGACCGGGCCCTTTGCCCC No data
Right 900146497 1:1161055-1161077 CCTTTGCCCCTCCTGCCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146497 Original CRISPR CCTTTGCCCCTCCTGCCCCC CGG Intergenic
No off target data available for this crispr