ID: 900146798

View in Genome Browser
Species Human (GRCh38)
Location 1:1162117-1162139
Sequence AGCCCAGATGGGGATGTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146788_900146798 8 Left 900146788 1:1162086-1162108 CCCACTCCAGGGGCTCCAAAGTA No data
Right 900146798 1:1162117-1162139 AGCCCAGATGGGGATGTTCCGGG No data
900146790_900146798 2 Left 900146790 1:1162092-1162114 CCAGGGGCTCCAAAGTAACCTCC No data
Right 900146798 1:1162117-1162139 AGCCCAGATGGGGATGTTCCGGG No data
900146791_900146798 -7 Left 900146791 1:1162101-1162123 CCAAAGTAACCTCCAGAGCCCAG No data
Right 900146798 1:1162117-1162139 AGCCCAGATGGGGATGTTCCGGG No data
900146786_900146798 10 Left 900146786 1:1162084-1162106 CCCCCACTCCAGGGGCTCCAAAG No data
Right 900146798 1:1162117-1162139 AGCCCAGATGGGGATGTTCCGGG No data
900146781_900146798 27 Left 900146781 1:1162067-1162089 CCCAAAGAAAACTTGAACCCCCA No data
Right 900146798 1:1162117-1162139 AGCCCAGATGGGGATGTTCCGGG No data
900146782_900146798 26 Left 900146782 1:1162068-1162090 CCAAAGAAAACTTGAACCCCCAC No data
Right 900146798 1:1162117-1162139 AGCCCAGATGGGGATGTTCCGGG No data
900146787_900146798 9 Left 900146787 1:1162085-1162107 CCCCACTCCAGGGGCTCCAAAGT No data
Right 900146798 1:1162117-1162139 AGCCCAGATGGGGATGTTCCGGG No data
900146789_900146798 7 Left 900146789 1:1162087-1162109 CCACTCCAGGGGCTCCAAAGTAA No data
Right 900146798 1:1162117-1162139 AGCCCAGATGGGGATGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146798 Original CRISPR AGCCCAGATGGGGATGTTCC GGG Intergenic