ID: 900146859

View in Genome Browser
Species Human (GRCh38)
Location 1:1162316-1162338
Sequence GACCCCCCGTAGGCCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900146859_900146870 13 Left 900146859 1:1162316-1162338 CCCACCTGGGCCTACGGGGGGTC No data
Right 900146870 1:1162352-1162374 AAAATTAAGGGCTGCGGGCCTGG No data
900146859_900146866 1 Left 900146859 1:1162316-1162338 CCCACCTGGGCCTACGGGGGGTC No data
Right 900146866 1:1162340-1162362 CTTCATTGCTCCAAAATTAAGGG No data
900146859_900146868 8 Left 900146859 1:1162316-1162338 CCCACCTGGGCCTACGGGGGGTC No data
Right 900146868 1:1162347-1162369 GCTCCAAAATTAAGGGCTGCGGG No data
900146859_900146867 7 Left 900146859 1:1162316-1162338 CCCACCTGGGCCTACGGGGGGTC No data
Right 900146867 1:1162346-1162368 TGCTCCAAAATTAAGGGCTGCGG No data
900146859_900146865 0 Left 900146859 1:1162316-1162338 CCCACCTGGGCCTACGGGGGGTC No data
Right 900146865 1:1162339-1162361 CCTTCATTGCTCCAAAATTAAGG No data
900146859_900146871 25 Left 900146859 1:1162316-1162338 CCCACCTGGGCCTACGGGGGGTC No data
Right 900146871 1:1162364-1162386 TGCGGGCCTGGAGCAAAGACAGG No data
900146859_900146872 29 Left 900146859 1:1162316-1162338 CCCACCTGGGCCTACGGGGGGTC No data
Right 900146872 1:1162368-1162390 GGCCTGGAGCAAAGACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900146859 Original CRISPR GACCCCCCGTAGGCCCAGGT GGG (reversed) Intergenic
No off target data available for this crispr