ID: 900147603

View in Genome Browser
Species Human (GRCh38)
Location 1:1165261-1165283
Sequence CCAGCTGAGCCTGCCGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900147595_900147603 -2 Left 900147595 1:1165240-1165262 CCCTGCGAAATCCTTGGTCCCCC No data
Right 900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG No data
900147592_900147603 16 Left 900147592 1:1165222-1165244 CCTGTGCCAGGCACAAGGCCCTG No data
Right 900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG No data
900147591_900147603 17 Left 900147591 1:1165221-1165243 CCCTGTGCCAGGCACAAGGCCCT No data
Right 900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG No data
900147593_900147603 10 Left 900147593 1:1165228-1165250 CCAGGCACAAGGCCCTGCGAAAT No data
Right 900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG No data
900147587_900147603 24 Left 900147587 1:1165214-1165236 CCCTCACCCCTGTGCCAGGCACA No data
Right 900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG No data
900147588_900147603 23 Left 900147588 1:1165215-1165237 CCTCACCCCTGTGCCAGGCACAA No data
Right 900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG No data
900147596_900147603 -3 Left 900147596 1:1165241-1165263 CCTGCGAAATCCTTGGTCCCCCA No data
Right 900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG No data
900147584_900147603 30 Left 900147584 1:1165208-1165230 CCTTGCCCCTCACCCCTGTGCCA No data
Right 900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG No data
900147586_900147603 25 Left 900147586 1:1165213-1165235 CCCCTCACCCCTGTGCCAGGCAC No data
Right 900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG No data
900147590_900147603 18 Left 900147590 1:1165220-1165242 CCCCTGTGCCAGGCACAAGGCCC No data
Right 900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900147603 Original CRISPR CCAGCTGAGCCTGCCGGCCC AGG Intergenic
No off target data available for this crispr