ID: 900155872

View in Genome Browser
Species Human (GRCh38)
Location 1:1203093-1203115
Sequence CTCCAGGTGAGATCTGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900155872_900155878 -5 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155878 1:1203111-1203133 TGGAGCCTGGAGTGGGAGGCTGG No data
900155872_900155882 0 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155882 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
900155872_900155885 10 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155885 1:1203126-1203148 GAGGCTGGGCGGGCCGAGGGTGG No data
900155872_900155876 -9 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155876 1:1203107-1203129 CACCTGGAGCCTGGAGTGGGAGG No data
900155872_900155888 20 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155888 1:1203136-1203158 GGGCCGAGGGTGGGATGGTGAGG No data
900155872_900155890 27 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155890 1:1203143-1203165 GGGTGGGATGGTGAGGAGAGAGG No data
900155872_900155886 11 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155886 1:1203127-1203149 AGGCTGGGCGGGCCGAGGGTGGG No data
900155872_900155884 7 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155884 1:1203123-1203145 TGGGAGGCTGGGCGGGCCGAGGG No data
900155872_900155887 15 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155887 1:1203131-1203153 TGGGCGGGCCGAGGGTGGGATGG No data
900155872_900155883 6 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155883 1:1203122-1203144 GTGGGAGGCTGGGCGGGCCGAGG No data
900155872_900155879 -4 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155879 1:1203112-1203134 GGAGCCTGGAGTGGGAGGCTGGG No data
900155872_900155891 28 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155891 1:1203144-1203166 GGTGGGATGGTGAGGAGAGAGGG No data
900155872_900155880 -1 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155880 1:1203115-1203137 GCCTGGAGTGGGAGGCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900155872 Original CRISPR CTCCAGGTGAGATCTGATAC AGG (reversed) Intergenic