ID: 900155877

View in Genome Browser
Species Human (GRCh38)
Location 1:1203109-1203131
Sequence AGCCTCCCACTCCAGGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900155877_900155892 16 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155892 1:1203148-1203170 GGATGGTGAGGAGAGAGGGCTGG No data
900155877_900155895 28 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155895 1:1203160-1203182 GAGAGGGCTGGCCTGGAGACGGG No data
900155877_900155886 -5 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155886 1:1203127-1203149 AGGCTGGGCGGGCCGAGGGTGGG No data
900155877_900155896 29 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155896 1:1203161-1203183 AGAGGGCTGGCCTGGAGACGGGG No data
900155877_900155891 12 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155891 1:1203144-1203166 GGTGGGATGGTGAGGAGAGAGGG No data
900155877_900155890 11 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155890 1:1203143-1203165 GGGTGGGATGGTGAGGAGAGAGG No data
900155877_900155893 21 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155893 1:1203153-1203175 GTGAGGAGAGAGGGCTGGCCTGG No data
900155877_900155885 -6 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155885 1:1203126-1203148 GAGGCTGGGCGGGCCGAGGGTGG No data
900155877_900155884 -9 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155884 1:1203123-1203145 TGGGAGGCTGGGCGGGCCGAGGG No data
900155877_900155894 27 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155894 1:1203159-1203181 AGAGAGGGCTGGCCTGGAGACGG No data
900155877_900155888 4 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155888 1:1203136-1203158 GGGCCGAGGGTGGGATGGTGAGG No data
900155877_900155883 -10 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155883 1:1203122-1203144 GTGGGAGGCTGGGCGGGCCGAGG No data
900155877_900155887 -1 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155887 1:1203131-1203153 TGGGCGGGCCGAGGGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900155877 Original CRISPR AGCCTCCCACTCCAGGCTCC AGG (reversed) Intergenic