ID: 900155881

View in Genome Browser
Species Human (GRCh38)
Location 1:1203116-1203138
Sequence CCCGCCCAGCCTCCCACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7841
Summary {0: 1, 1: 0, 2: 7, 3: 356, 4: 7477}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900155881_900155896 22 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG 0: 1
1: 0
2: 7
3: 356
4: 7477
Right 900155896 1:1203161-1203183 AGAGGGCTGGCCTGGAGACGGGG 0: 1
1: 0
2: 5
3: 43
4: 410
900155881_900155891 5 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG 0: 1
1: 0
2: 7
3: 356
4: 7477
Right 900155891 1:1203144-1203166 GGTGGGATGGTGAGGAGAGAGGG 0: 1
1: 0
2: 18
3: 175
4: 1195
900155881_900155895 21 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG 0: 1
1: 0
2: 7
3: 356
4: 7477
Right 900155895 1:1203160-1203182 GAGAGGGCTGGCCTGGAGACGGG 0: 1
1: 0
2: 7
3: 62
4: 544
900155881_900155893 14 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG 0: 1
1: 0
2: 7
3: 356
4: 7477
Right 900155893 1:1203153-1203175 GTGAGGAGAGAGGGCTGGCCTGG 0: 1
1: 0
2: 6
3: 85
4: 717
900155881_900155894 20 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG 0: 1
1: 0
2: 7
3: 356
4: 7477
Right 900155894 1:1203159-1203181 AGAGAGGGCTGGCCTGGAGACGG 0: 1
1: 1
2: 6
3: 118
4: 622
900155881_900155890 4 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG 0: 1
1: 0
2: 7
3: 356
4: 7477
Right 900155890 1:1203143-1203165 GGGTGGGATGGTGAGGAGAGAGG 0: 1
1: 0
2: 15
3: 165
4: 1875
900155881_900155888 -3 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG 0: 1
1: 0
2: 7
3: 356
4: 7477
Right 900155888 1:1203136-1203158 GGGCCGAGGGTGGGATGGTGAGG 0: 1
1: 0
2: 18
3: 79
4: 737
900155881_900155892 9 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG 0: 1
1: 0
2: 7
3: 356
4: 7477
Right 900155892 1:1203148-1203170 GGATGGTGAGGAGAGAGGGCTGG 0: 1
1: 1
2: 7
3: 153
4: 1416
900155881_900155887 -8 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG 0: 1
1: 0
2: 7
3: 356
4: 7477
Right 900155887 1:1203131-1203153 TGGGCGGGCCGAGGGTGGGATGG 0: 1
1: 0
2: 2
3: 43
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900155881 Original CRISPR CCCGCCCAGCCTCCCACTCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr