ID: 900155881

View in Genome Browser
Species Human (GRCh38)
Location 1:1203116-1203138
Sequence CCCGCCCAGCCTCCCACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900155881_900155893 14 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155893 1:1203153-1203175 GTGAGGAGAGAGGGCTGGCCTGG No data
900155881_900155896 22 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155896 1:1203161-1203183 AGAGGGCTGGCCTGGAGACGGGG No data
900155881_900155892 9 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155892 1:1203148-1203170 GGATGGTGAGGAGAGAGGGCTGG No data
900155881_900155895 21 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155895 1:1203160-1203182 GAGAGGGCTGGCCTGGAGACGGG No data
900155881_900155890 4 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155890 1:1203143-1203165 GGGTGGGATGGTGAGGAGAGAGG No data
900155881_900155887 -8 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155887 1:1203131-1203153 TGGGCGGGCCGAGGGTGGGATGG No data
900155881_900155888 -3 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155888 1:1203136-1203158 GGGCCGAGGGTGGGATGGTGAGG No data
900155881_900155894 20 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155894 1:1203159-1203181 AGAGAGGGCTGGCCTGGAGACGG No data
900155881_900155891 5 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155891 1:1203144-1203166 GGTGGGATGGTGAGGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900155881 Original CRISPR CCCGCCCAGCCTCCCACTCC AGG (reversed) Intergenic