ID: 900155888

View in Genome Browser
Species Human (GRCh38)
Location 1:1203136-1203158
Sequence GGGCCGAGGGTGGGATGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900155881_900155888 -3 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155888 1:1203136-1203158 GGGCCGAGGGTGGGATGGTGAGG No data
900155877_900155888 4 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155888 1:1203136-1203158 GGGCCGAGGGTGGGATGGTGAGG No data
900155872_900155888 20 Left 900155872 1:1203093-1203115 CCTGTATCAGATCTCACCTGGAG No data
Right 900155888 1:1203136-1203158 GGGCCGAGGGTGGGATGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900155888 Original CRISPR GGGCCGAGGGTGGGATGGTG AGG Intergenic