ID: 900155889

View in Genome Browser
Species Human (GRCh38)
Location 1:1203139-1203161
Sequence TCTCCTCACCATCCCACCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900155889_900155899 23 Left 900155889 1:1203139-1203161 CCGAGGGTGGGATGGTGAGGAGA No data
Right 900155899 1:1203185-1203207 CGCCCAGCACCAGAAAGTGCTGG No data
900155889_900155894 -3 Left 900155889 1:1203139-1203161 CCGAGGGTGGGATGGTGAGGAGA No data
Right 900155894 1:1203159-1203181 AGAGAGGGCTGGCCTGGAGACGG No data
900155889_900155896 -1 Left 900155889 1:1203139-1203161 CCGAGGGTGGGATGGTGAGGAGA No data
Right 900155896 1:1203161-1203183 AGAGGGCTGGCCTGGAGACGGGG No data
900155889_900155902 27 Left 900155889 1:1203139-1203161 CCGAGGGTGGGATGGTGAGGAGA No data
Right 900155902 1:1203189-1203211 CAGCACCAGAAAGTGCTGGATGG No data
900155889_900155895 -2 Left 900155889 1:1203139-1203161 CCGAGGGTGGGATGGTGAGGAGA No data
Right 900155895 1:1203160-1203182 GAGAGGGCTGGCCTGGAGACGGG No data
900155889_900155893 -9 Left 900155889 1:1203139-1203161 CCGAGGGTGGGATGGTGAGGAGA No data
Right 900155893 1:1203153-1203175 GTGAGGAGAGAGGGCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900155889 Original CRISPR TCTCCTCACCATCCCACCCT CGG (reversed) Intergenic