ID: 900155893

View in Genome Browser
Species Human (GRCh38)
Location 1:1203153-1203175
Sequence GTGAGGAGAGAGGGCTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900155877_900155893 21 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155893 1:1203153-1203175 GTGAGGAGAGAGGGCTGGCCTGG No data
900155889_900155893 -9 Left 900155889 1:1203139-1203161 CCGAGGGTGGGATGGTGAGGAGA No data
Right 900155893 1:1203153-1203175 GTGAGGAGAGAGGGCTGGCCTGG No data
900155881_900155893 14 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155893 1:1203153-1203175 GTGAGGAGAGAGGGCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900155893 Original CRISPR GTGAGGAGAGAGGGCTGGCC TGG Intergenic