ID: 900155895

View in Genome Browser
Species Human (GRCh38)
Location 1:1203160-1203182
Sequence GAGAGGGCTGGCCTGGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900155889_900155895 -2 Left 900155889 1:1203139-1203161 CCGAGGGTGGGATGGTGAGGAGA No data
Right 900155895 1:1203160-1203182 GAGAGGGCTGGCCTGGAGACGGG No data
900155877_900155895 28 Left 900155877 1:1203109-1203131 CCTGGAGCCTGGAGTGGGAGGCT No data
Right 900155895 1:1203160-1203182 GAGAGGGCTGGCCTGGAGACGGG No data
900155881_900155895 21 Left 900155881 1:1203116-1203138 CCTGGAGTGGGAGGCTGGGCGGG No data
Right 900155895 1:1203160-1203182 GAGAGGGCTGGCCTGGAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900155895 Original CRISPR GAGAGGGCTGGCCTGGAGAC GGG Intergenic